Incidental Mutation 'R9478:2210408I21Rik'
ID 715947
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene Name RIKEN cDNA 2210408I21 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9478 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 77135540-77613784 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77303454 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 886 (I886F)
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000168779
AA Change: I886F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: I886F

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,610,358 S134P unknown Het
Abcf2 A G 5: 24,565,942 L604P possibly damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atg14 G T 14: 47,545,681 H373Q probably damaging Het
Atmin C T 8: 116,954,798 H179Y probably damaging Het
Catsperg1 G T 7: 29,198,352 P197T possibly damaging Het
Ccdc189 T C 7: 127,584,915 probably null Het
Ccdc7b C T 8: 129,110,992 Q155* probably null Het
Cep85l T G 10: 53,348,779 E238A possibly damaging Het
Cntln G A 4: 84,979,393 V406I probably benign Het
Csf2rb2 C A 15: 78,284,765 G730V probably benign Het
Cyp3a59 T A 5: 146,098,187 L225Q probably damaging Het
Dock1 T A 7: 134,766,233 F511I probably damaging Het
Dsg1b A T 18: 20,397,951 Y453F Het
Dync1h1 T C 12: 110,658,703 F3829L probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Esco2 C A 14: 65,831,208 G218* probably null Het
Gale C T 4: 135,965,263 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hgf A G 5: 16,561,031 D55G possibly damaging Het
Il17ra A G 6: 120,474,375 D170G possibly damaging Het
Inha A G 1: 75,509,918 S286G probably benign Het
Kdelc2 T C 9: 53,391,936 F232L probably damaging Het
Kif1b C T 4: 149,261,159 probably null Het
Klhl24 T G 16: 20,123,013 S570R possibly damaging Het
Krt83 G A 15: 101,487,568 R308W probably benign Het
Lama2 T A 10: 27,015,482 E2545V probably damaging Het
Lztfl1 T C 9: 123,708,102 K165E possibly damaging Het
Mab21l3 A T 3: 101,818,671 D336E probably damaging Het
Matn2 T C 15: 34,345,096 I83T probably damaging Het
Mfsd9 T C 1: 40,773,781 D458G probably benign Het
Ncbp3 A G 11: 73,077,942 D513G probably damaging Het
Neb T A 2: 52,188,776 K5818N probably benign Het
Nol4 G A 18: 22,920,877 P120S probably damaging Het
Oit3 C A 10: 59,438,642 C112F probably damaging Het
Olfr1270 C A 2: 90,149,251 A252S possibly damaging Het
Olfr472 G A 7: 107,903,031 V105M probably damaging Het
Olfr743 A T 14: 50,533,594 T61S probably benign Het
Olfr782 T A 10: 129,351,091 M176K possibly damaging Het
Pank4 G A 4: 154,980,108 R708Q probably benign Het
Plch1 T A 3: 63,699,404 L1026F probably benign Het
Ptpn3 A T 4: 57,197,573 I772N probably damaging Het
Purb A G 11: 6,475,424 F155L probably damaging Het
Rcor2 C T 19: 7,271,429 R256W probably damaging Het
Rp1 A G 1: 4,347,322 L1189P probably benign Het
Scn1a T C 2: 66,326,149 E472G probably benign Het
Sema3e T C 5: 14,236,372 Y536H probably damaging Het
Serpina3n A T 12: 104,412,413 I331F possibly damaging Het
Sertad3 T C 7: 27,476,254 S38P probably damaging Het
Sfrp4 G T 13: 19,623,440 R3L unknown Het
Slc35a5 T C 16: 45,144,063 E269G probably damaging Het
Snrnp200 G A 2: 127,235,073 probably null Het
Sumo1 A G 1: 59,655,456 probably null Het
Syne2 A G 12: 76,107,613 K2020E probably damaging Het
Tcp10a A T 17: 7,334,341 T247S probably benign Het
Tgds T C 14: 118,115,132 D290G possibly damaging Het
Trav7d-3 A T 14: 52,744,597 I32F possibly damaging Het
Vps41 A G 13: 18,862,743 N788D Het
Zfp521 G A 18: 13,817,315 T1194I probably damaging Het
Zmynd8 C A 2: 165,807,649 K841N probably damaging Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
PIT4651001:2210408I21Rik UTSW 13 77259895 missense probably benign
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2329:2210408I21Rik UTSW 13 77303325 missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77267849 missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 splice site probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77245327 missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77267808 splice site probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77327902 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6588:2210408I21Rik UTSW 13 77192647 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77303402 missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
R7079:2210408I21Rik UTSW 13 77254204 missense possibly damaging 0.86
R7130:2210408I21Rik UTSW 13 77269902 missense possibly damaging 0.93
R7215:2210408I21Rik UTSW 13 77323571 missense possibly damaging 0.96
R7272:2210408I21Rik UTSW 13 77323536 missense probably benign 0.00
R7331:2210408I21Rik UTSW 13 77183609 missense possibly damaging 0.53
R7561:2210408I21Rik UTSW 13 77193195 missense probably benign
R7684:2210408I21Rik UTSW 13 77612540 nonsense probably null
R7728:2210408I21Rik UTSW 13 77316477 missense possibly damaging 0.96
R7881:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R7963:2210408I21Rik UTSW 13 77192554 missense probably benign 0.02
R8008:2210408I21Rik UTSW 13 77281115 missense probably benign 0.28
R8024:2210408I21Rik UTSW 13 77612594 missense probably benign
R8170:2210408I21Rik UTSW 13 77263594 missense probably benign 0.06
R8201:2210408I21Rik UTSW 13 77193159 missense possibly damaging 0.72
R8255:2210408I21Rik UTSW 13 77267731 missense possibly damaging 0.71
R8296:2210408I21Rik UTSW 13 77267777 missense probably damaging 0.98
R8476:2210408I21Rik UTSW 13 77261901 missense possibly damaging 0.92
R8526:2210408I21Rik UTSW 13 77269816 nonsense probably null
R8746:2210408I21Rik UTSW 13 77303410 missense probably benign 0.01
R8812:2210408I21Rik UTSW 13 77332352 missense probably damaging 0.98
R8870:2210408I21Rik UTSW 13 77323721 missense possibly damaging 0.96
R8885:2210408I21Rik UTSW 13 77323406 missense possibly damaging 0.91
R8910:2210408I21Rik UTSW 13 77323649 missense probably benign 0.03
R8911:2210408I21Rik UTSW 13 77281115 missense probably benign 0.28
R8965:2210408I21Rik UTSW 13 77612604 missense probably benign 0.02
R8968:2210408I21Rik UTSW 13 77332310 nonsense probably null
R8989:2210408I21Rik UTSW 13 77612605 missense probably benign 0.01
R9163:2210408I21Rik UTSW 13 77245281 missense possibly damaging 0.73
R9378:2210408I21Rik UTSW 13 77323616 missense possibly damaging 0.53
R9523:2210408I21Rik UTSW 13 77259869 missense possibly damaging 0.53
R9595:2210408I21Rik UTSW 13 77316447 missense probably benign
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTGCTTCTCAACTGCAC -3'
(R):5'- TCCCAAGTATATCACATTTAACAGGAG -3'

Sequencing Primer
(F):5'- GGTGCTTCTCAACTGCACTAAGAAG -3'
(R):5'- GCATCAACCTTTGAAAGC -3'
Posted On 2022-06-15