Incidental Mutation 'R9478:Tgds'
ID 715953
Institutional Source Beutler Lab
Gene Symbol Tgds
Ensembl Gene ENSMUSG00000022130
Gene Name TDP-glucose 4,6-dehydratase
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock # R9478 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 118111911-118132755 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118115132 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 290 (D290G)
Ref Sequence ENSEMBL: ENSMUSP00000022727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022727] [ENSMUST00000227350] [ENSMUST00000228543]
AlphaFold Q8VDR7
Predicted Effect possibly damaging
Transcript: ENSMUST00000022727
AA Change: D290G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022727
Gene: ENSMUSG00000022130
AA Change: D290G

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 18 333 2.9e-27 PFAM
Pfam:Epimerase 20 258 3.2e-61 PFAM
Pfam:Polysacc_synt_2 20 300 2.6e-27 PFAM
Pfam:3Beta_HSD 21 248 3.2e-29 PFAM
Pfam:GDP_Man_Dehyd 21 327 2.3e-77 PFAM
Pfam:NAD_binding_4 22 230 9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227350
Predicted Effect possibly damaging
Transcript: ENSMUST00000228543
AA Change: D290G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the short-chain dehydrogenases/reductases (SDR) superfamily, and is thought to contain a nicotinamide adenine dinucleotide (NAD) binding domain. This large SDR family of enzymes is involved in the metabolism of a variety of compounds, including prostaglandins, retinoids, lipids, steroid hormones, and xenobiotics. Mutations in this gene have been associated with Catel-Manzke syndrome, which is characterized by Pierre Robin sequence, and radial deviation of the index finger due to the presence of an accessory bone between the index finger and its proximal phalanx. Pierre Robin sequence is defined by an undersized jaw, backwards displacement of the tongue base that causes an obstruction of the airways, and can also be associated with a cleft palate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,454 I886F possibly damaging Het
3100002H09Rik A G 4: 124,610,358 S134P unknown Het
Abcf2 A G 5: 24,565,942 L604P possibly damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atg14 G T 14: 47,545,681 H373Q probably damaging Het
Atmin C T 8: 116,954,798 H179Y probably damaging Het
Catsperg1 G T 7: 29,198,352 P197T possibly damaging Het
Ccdc189 T C 7: 127,584,915 probably null Het
Ccdc7b C T 8: 129,110,992 Q155* probably null Het
Cep85l T G 10: 53,348,779 E238A possibly damaging Het
Cntln G A 4: 84,979,393 V406I probably benign Het
Csf2rb2 C A 15: 78,284,765 G730V probably benign Het
Cyp3a59 T A 5: 146,098,187 L225Q probably damaging Het
Dock1 T A 7: 134,766,233 F511I probably damaging Het
Dsg1b A T 18: 20,397,951 Y453F Het
Dync1h1 T C 12: 110,658,703 F3829L probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Esco2 C A 14: 65,831,208 G218* probably null Het
Gale C T 4: 135,965,263 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hgf A G 5: 16,561,031 D55G possibly damaging Het
Il17ra A G 6: 120,474,375 D170G possibly damaging Het
Inha A G 1: 75,509,918 S286G probably benign Het
Kdelc2 T C 9: 53,391,936 F232L probably damaging Het
Kif1b C T 4: 149,261,159 probably null Het
Klhl24 T G 16: 20,123,013 S570R possibly damaging Het
Krt83 G A 15: 101,487,568 R308W probably benign Het
Lama2 T A 10: 27,015,482 E2545V probably damaging Het
Lztfl1 T C 9: 123,708,102 K165E possibly damaging Het
Mab21l3 A T 3: 101,818,671 D336E probably damaging Het
Matn2 T C 15: 34,345,096 I83T probably damaging Het
Mfsd9 T C 1: 40,773,781 D458G probably benign Het
Ncbp3 A G 11: 73,077,942 D513G probably damaging Het
Neb T A 2: 52,188,776 K5818N probably benign Het
Nol4 G A 18: 22,920,877 P120S probably damaging Het
Oit3 C A 10: 59,438,642 C112F probably damaging Het
Olfr1270 C A 2: 90,149,251 A252S possibly damaging Het
Olfr472 G A 7: 107,903,031 V105M probably damaging Het
Olfr743 A T 14: 50,533,594 T61S probably benign Het
Olfr782 T A 10: 129,351,091 M176K possibly damaging Het
Pank4 G A 4: 154,980,108 R708Q probably benign Het
Plch1 T A 3: 63,699,404 L1026F probably benign Het
Ptpn3 A T 4: 57,197,573 I772N probably damaging Het
Purb A G 11: 6,475,424 F155L probably damaging Het
Rcor2 C T 19: 7,271,429 R256W probably damaging Het
Rp1 A G 1: 4,347,322 L1189P probably benign Het
Scn1a T C 2: 66,326,149 E472G probably benign Het
Sema3e T C 5: 14,236,372 Y536H probably damaging Het
Serpina3n A T 12: 104,412,413 I331F possibly damaging Het
Sertad3 T C 7: 27,476,254 S38P probably damaging Het
Sfrp4 G T 13: 19,623,440 R3L unknown Het
Slc35a5 T C 16: 45,144,063 E269G probably damaging Het
Snrnp200 G A 2: 127,235,073 probably null Het
Sumo1 A G 1: 59,655,456 probably null Het
Syne2 A G 12: 76,107,613 K2020E probably damaging Het
Tcp10a A T 17: 7,334,341 T247S probably benign Het
Trav7d-3 A T 14: 52,744,597 I32F possibly damaging Het
Vps41 A G 13: 18,862,743 N788D Het
Zfp521 G A 18: 13,817,315 T1194I probably damaging Het
Zmynd8 C A 2: 165,807,649 K841N probably damaging Het
Other mutations in Tgds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Tgds APN 14 118128214 splice site probably benign
IGL01521:Tgds APN 14 118113094 missense probably damaging 1.00
IGL01928:Tgds APN 14 118116129 missense probably benign 0.04
IGL02134:Tgds APN 14 118113122 missense probably benign 0.03
IGL03353:Tgds APN 14 118127507 nonsense probably null
R0079:Tgds UTSW 14 118116235 missense possibly damaging 0.76
R2005:Tgds UTSW 14 118130656 missense possibly damaging 0.51
R2104:Tgds UTSW 14 118121737 nonsense probably null
R4676:Tgds UTSW 14 118116231 missense probably benign 0.01
R4801:Tgds UTSW 14 118117033 intron probably benign
R4992:Tgds UTSW 14 118117763 missense probably damaging 1.00
R5051:Tgds UTSW 14 118128227 missense probably damaging 1.00
R5083:Tgds UTSW 14 118116079 splice site probably null
R5802:Tgds UTSW 14 118132707 missense probably benign 0.00
R9786:Tgds UTSW 14 118130637 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTTGGGAAGGGAATTCAC -3'
(R):5'- AGAACCTTTGCTGTCCTGC -3'

Sequencing Primer
(F):5'- TCATATAAGCACCTATGGCTTCAC -3'
(R):5'- CTCCCTCCCGCTGTGAG -3'
Posted On 2022-06-15