Mutagenetix > Incidental Mutation

Incidental Mutation 'R9478:Matn2'

715954

Institutional Source

Beutler Lab

Gene Symbol

Matn2

Ensembl Gene

ENSMUSG00000022324

Gene Name

matrilin 2

Synonyms

Crtm2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9478 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34306677-34436273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34345096 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 83 (I83T)

Ref Sequence

ENSEMBL: ENSMUSP00000022947 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022947] [ENSMUST00000163455] [ENSMUST00000179647] [ENSMUST00000226766] [ENSMUST00000227759] [ENSMUST00000227772] [ENSMUST00000228570]

AlphaFold

O08746

Predicted Effect

probably damaging
Transcript: ENSMUST00000022947
AA Change: I83T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022947
Gene: ENSMUSG00000022324
AA Change: I83T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWA	55	237	1.99e-49	SMART
EGF	241	278	6.86e-4	SMART
EGF	282	319	5.49e-3	SMART
EGF	323	360	7.88e-4	SMART
EGF	364	401	6.76e-3	SMART
EGF	405	442	4.39e-2	SMART
EGF	446	483	9.41e-2	SMART
EGF	487	524	1.24e-1	SMART
EGF	528	565	2.23e-3	SMART
EGF	569	606	8.44e-4	SMART
EGF	610	647	9.55e-3	SMART
VWA	653	831	1.14e-49	SMART
Matrilin_ccoil	889	935	4.78e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163455
AA Change: I83T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000128202
Gene: ENSMUSG00000022324
AA Change: I83T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWA	55	237	1.99e-49	SMART
EGF	241	278	6.86e-4	SMART
EGF	282	319	5.49e-3	SMART
EGF	323	360	7.88e-4	SMART
EGF	364	401	6.76e-3	SMART
EGF	405	442	4.39e-2	SMART
EGF	446	483	9.41e-2	SMART
EGF	487	524	1.24e-1	SMART
EGF	528	565	2.23e-3	SMART
EGF	569	606	8.44e-4	SMART
EGF	610	647	9.55e-3	SMART
VWA	653	831	1.14e-49	SMART
Matrilin_ccoil	908	955	7.77e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179647

Predicted Effect

probably benign
Transcript: ENSMUST00000226766
AA Change: I83T

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227759
AA Change: I83T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000227772

Predicted Effect

probably damaging
Transcript: ENSMUST00000228570
AA Change: I83T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains five von Willebrand factor A domains. The specific function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no obvious abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	T	13: 77,303,454	I886F	possibly damaging	Het
3100002H09Rik	A	G	4: 124,610,358	S134P	unknown	Het
Abcf2	A	G	5: 24,565,942	L604P	possibly damaging	Het
Arih2	C	G	9: 108,611,739	R260P	probably damaging	Het
Atg14	G	T	14: 47,545,681	H373Q	probably damaging	Het
Atmin	C	T	8: 116,954,798	H179Y	probably damaging	Het
Catsperg1	G	T	7: 29,198,352	P197T	possibly damaging	Het
Ccdc189	T	C	7: 127,584,915		probably null	Het
Ccdc7b	C	T	8: 129,110,992	Q155*	probably null	Het
Cep85l	T	G	10: 53,348,779	E238A	possibly damaging	Het
Cntln	G	A	4: 84,979,393	V406I	probably benign	Het
Csf2rb2	C	A	15: 78,284,765	G730V	probably benign	Het
Cyp3a59	T	A	5: 146,098,187	L225Q	probably damaging	Het
Dock1	T	A	7: 134,766,233	F511I	probably damaging	Het
Dsg1b	A	T	18: 20,397,951	Y453F		Het
Dync1h1	T	C	12: 110,658,703	F3829L	probably benign	Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Esco2	C	A	14: 65,831,208	G218*	probably null	Het
Gale	C	T	4: 135,965,263		probably benign	Het
Grid1	G	A	14: 35,321,707	D340N	probably damaging	Het
Hgf	A	G	5: 16,561,031	D55G	possibly damaging	Het
Il17ra	A	G	6: 120,474,375	D170G	possibly damaging	Het
Inha	A	G	1: 75,509,918	S286G	probably benign	Het
Kdelc2	T	C	9: 53,391,936	F232L	probably damaging	Het
Kif1b	C	T	4: 149,261,159		probably null	Het
Klhl24	T	G	16: 20,123,013	S570R	possibly damaging	Het
Krt83	G	A	15: 101,487,568	R308W	probably benign	Het
Lama2	T	A	10: 27,015,482	E2545V	probably damaging	Het
Lztfl1	T	C	9: 123,708,102	K165E	possibly damaging	Het
Mab21l3	A	T	3: 101,818,671	D336E	probably damaging	Het
Mfsd9	T	C	1: 40,773,781	D458G	probably benign	Het
Ncbp3	A	G	11: 73,077,942	D513G	probably damaging	Het
Neb	T	A	2: 52,188,776	K5818N	probably benign	Het
Nol4	G	A	18: 22,920,877	P120S	probably damaging	Het
Oit3	C	A	10: 59,438,642	C112F	probably damaging	Het
Olfr1270	C	A	2: 90,149,251	A252S	possibly damaging	Het
Olfr472	G	A	7: 107,903,031	V105M	probably damaging	Het
Olfr743	A	T	14: 50,533,594	T61S	probably benign	Het
Olfr782	T	A	10: 129,351,091	M176K	possibly damaging	Het
Pank4	G	A	4: 154,980,108	R708Q	probably benign	Het
Plch1	T	A	3: 63,699,404	L1026F	probably benign	Het
Ptpn3	A	T	4: 57,197,573	I772N	probably damaging	Het
Purb	A	G	11: 6,475,424	F155L	probably damaging	Het
Rcor2	C	T	19: 7,271,429	R256W	probably damaging	Het
Rp1	A	G	1: 4,347,322	L1189P	probably benign	Het
Scn1a	T	C	2: 66,326,149	E472G	probably benign	Het
Sema3e	T	C	5: 14,236,372	Y536H	probably damaging	Het
Serpina3n	A	T	12: 104,412,413	I331F	possibly damaging	Het
Sertad3	T	C	7: 27,476,254	S38P	probably damaging	Het
Sfrp4	G	T	13: 19,623,440	R3L	unknown	Het
Slc35a5	T	C	16: 45,144,063	E269G	probably damaging	Het
Snrnp200	G	A	2: 127,235,073		probably null	Het
Sumo1	A	G	1: 59,655,456		probably null	Het
Syne2	A	G	12: 76,107,613	K2020E	probably damaging	Het
Tcp10a	A	T	17: 7,334,341	T247S	probably benign	Het
Tgds	T	C	14: 118,115,132	D290G	possibly damaging	Het
Trav7d-3	A	T	14: 52,744,597	I32F	possibly damaging	Het
Vps41	A	G	13: 18,862,743	N788D		Het
Zfp521	G	A	18: 13,817,315	T1194I	probably damaging	Het
Zmynd8	C	A	2: 165,807,649	K841N	probably damaging	Het

Other mutations in Matn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Matn2	APN	15	34428470	missense	probably damaging	1.00
IGL00392:Matn2	APN	15	34402856	missense	probably benign	0.00
IGL01475:Matn2	APN	15	34316525	missense	possibly damaging	0.94
IGL02223:Matn2	APN	15	34423718	missense	probably benign	0.00
IGL02252:Matn2	APN	15	34316590	missense	probably damaging	0.98
IGL02288:Matn2	APN	15	34422386	missense	probably damaging	1.00
IGL02738:Matn2	APN	15	34388739	missense	probably benign	0.07
IGL02927:Matn2	APN	15	34355655	missense	probably damaging	1.00
IGL03331:Matn2	APN	15	34345357	missense	probably damaging	1.00
Engorged	UTSW	15	34426234	missense	probably damaging	1.00
PIT4260001:Matn2	UTSW	15	34428731	missense	possibly damaging	0.78
R0124:Matn2	UTSW	15	34426151	splice site	probably benign
R0422:Matn2	UTSW	15	34435771	splice site	probably null
R0449:Matn2	UTSW	15	34428541	missense	probably damaging	1.00
R0606:Matn2	UTSW	15	34345150	missense	probably damaging	1.00
R0655:Matn2	UTSW	15	34345200	missense	probably benign	0.03
R0885:Matn2	UTSW	15	34316605	missense	possibly damaging	0.67
R1384:Matn2	UTSW	15	34409810	missense	probably benign	0.00
R1603:Matn2	UTSW	15	34388768	missense	probably damaging	1.00
R1667:Matn2	UTSW	15	34378732	missense	probably damaging	0.99
R1720:Matn2	UTSW	15	34345274	nonsense	probably null
R1772:Matn2	UTSW	15	34428785	missense	probably damaging	0.99
R2037:Matn2	UTSW	15	34433117	missense	probably benign	0.00
R2107:Matn2	UTSW	15	34423759	missense	probably damaging	1.00
R2240:Matn2	UTSW	15	34433063	missense	probably damaging	1.00
R3933:Matn2	UTSW	15	34345420	splice site	probably null
R3963:Matn2	UTSW	15	34388791	nonsense	probably null
R4648:Matn2	UTSW	15	34428533	missense	probably damaging	1.00
R4695:Matn2	UTSW	15	34402925	missense	probably damaging	1.00
R4817:Matn2	UTSW	15	34423799	missense	probably damaging	1.00
R4935:Matn2	UTSW	15	34428685	missense	probably damaging	1.00
R5105:Matn2	UTSW	15	34355668	missense	possibly damaging	0.95
R5177:Matn2	UTSW	15	34433514	missense	possibly damaging	0.58
R5717:Matn2	UTSW	15	34399091	nonsense	probably null
R5760:Matn2	UTSW	15	34355607	missense	possibly damaging	0.46
R5776:Matn2	UTSW	15	34431619	missense	probably damaging	1.00
R5842:Matn2	UTSW	15	34399056	missense	probably damaging	0.99
R5917:Matn2	UTSW	15	34409766	nonsense	probably null
R5964:Matn2	UTSW	15	34410165	missense	probably damaging	1.00
R6265:Matn2	UTSW	15	34399155	missense	probably damaging	1.00
R6272:Matn2	UTSW	15	34355607	missense	possibly damaging	0.46
R6332:Matn2	UTSW	15	34423755	missense	probably benign	0.00
R6457:Matn2	UTSW	15	34426234	missense	probably damaging	1.00
R7351:Matn2	UTSW	15	34345336	missense	probably damaging	0.97
R7660:Matn2	UTSW	15	34402946	missense	probably benign	0.00
R7660:Matn2	UTSW	15	34423728	nonsense	probably null
R7775:Matn2	UTSW	15	34399077	missense	possibly damaging	0.94
R7778:Matn2	UTSW	15	34399077	missense	possibly damaging	0.94
R8007:Matn2	UTSW	15	34426169	missense	probably benign	0.01
R8059:Matn2	UTSW	15	34345335	missense	probably damaging	1.00
R8174:Matn2	UTSW	15	34422409	missense	probably benign	0.30
R8331:Matn2	UTSW	15	34428681	missense	probably damaging	1.00
R8354:Matn2	UTSW	15	34378697	missense	probably damaging	0.98
R8377:Matn2	UTSW	15	34345365	missense	probably damaging	1.00
R8393:Matn2	UTSW	15	34355602	missense	possibly damaging	0.92
R8532:Matn2	UTSW	15	34316553	missense	probably benign	0.42
R8555:Matn2	UTSW	15	34423805	missense	probably benign	0.03
R8756:Matn2	UTSW	15	34423730	missense	possibly damaging	0.94
R8973:Matn2	UTSW	15	34433050	missense	probably benign	0.01
R9198:Matn2	UTSW	15	34423778	missense	probably damaging	0.99
R9220:Matn2	UTSW	15	34410179	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GAGTTGGCCCTTTACCCATG -3'
(R):5'- GCATATTGGATGGCAAGCCC -3'

Sequencing Primer
(F):5'- CCTTGGCTAGACTTGGAACTAGC -3'
(R):5'- TGGCAAGCCCTGTCATG -3'

Posted On

2022-06-15