Mutagenetix > Incidental Mutation

Incidental Mutation 'R9343:Phf14'

715975

Institutional Source

Beutler Lab

Gene Symbol

Phf14

Ensembl Gene

ENSMUSG00000029629

Gene Name

PHD finger protein 14

Synonyms

5730446A07Rik, 4932409F11Rik, 1110001C23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9343 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11907809-12081205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 11961564 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 400 (V400D)

Ref Sequence

ENSEMBL: ENSMUSP00000111172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090632] [ENSMUST00000115510] [ENSMUST00000115511]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000090632
AA Change: V400D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088126
Gene: ENSMUSG00000029629
AA Change: V400D

Domain	Start	End	E-Value	Type
low complexity region	34	48	N/A	INTRINSIC
coiled coil region	61	89	N/A	INTRINSIC
low complexity region	97	130	N/A	INTRINSIC
low complexity region	131	166	N/A	INTRINSIC
low complexity region	223	251	N/A	INTRINSIC
PHD	314	371	1.64e-9	SMART
PHD	433	492	1.18e-6	SMART
coiled coil region	620	671	N/A	INTRINSIC
PHD	720	770	9.54e-11	SMART
low complexity region	830	848	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115510
AA Change: V400D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111172
Gene: ENSMUSG00000029629
AA Change: V400D

Domain	Start	End	E-Value	Type
low complexity region	34	48	N/A	INTRINSIC
coiled coil region	61	89	N/A	INTRINSIC
low complexity region	97	130	N/A	INTRINSIC
low complexity region	131	166	N/A	INTRINSIC
low complexity region	223	251	N/A	INTRINSIC
PHD	314	371	1.64e-9	SMART
PHD	433	492	1.18e-6	SMART
coiled coil region	620	671	N/A	INTRINSIC
PHD	720	770	9.54e-11	SMART
low complexity region	830	848	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115511
AA Change: V400D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111173
Gene: ENSMUSG00000029629
AA Change: V400D

Domain	Start	End	E-Value	Type
low complexity region	34	48	N/A	INTRINSIC
coiled coil region	61	89	N/A	INTRINSIC
low complexity region	97	130	N/A	INTRINSIC
low complexity region	131	166	N/A	INTRINSIC
low complexity region	223	251	N/A	INTRINSIC
PHD	314	371	1.64e-9	SMART
RING	315	381	1.21e1	SMART
PHD	433	492	1.18e-6	SMART
coiled coil region	620	671	N/A	INTRINSIC
PHD	720	770	9.54e-11	SMART
RING	721	769	2.63e0	SMART
low complexity region	830	848	N/A	INTRINSIC
PHD	863	912	9.92e-9	SMART
RING	864	911	3.17e0	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000115485
Gene: ENSMUSG00000029629
AA Change: V125D

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
PHD	40	97	1.64e-9	SMART
PHD	159	218	1.18e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (45/45)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality due to respiratory failure, pulmonary wall hypertrophy, abnormal sternum ossification, and increased proliferation of bone marrow-derived mesenchymal cells and mouse embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	A	G	2: 103,717,160	I960V	probably benign	Het
Alpk3	A	G	7: 81,092,331	D632G	probably benign	Het
Aplp2	A	T	9: 31,211,639	L30Q	unknown	Het
Axl	A	T	7: 25,774,119	Y361N	probably damaging	Het
Brinp2	A	T	1: 158,249,520		probably benign	Het
Bsn	T	C	9: 108,115,502	D1017G	probably damaging	Het
Cc2d2a	A	T	5: 43,718,657	D1046V	probably damaging	Het
Cdc42bpg	G	A	19: 6,314,523	G594S	probably damaging	Het
Clcn6	A	G	4: 148,014,001	S519P	probably benign	Het
Cnot2	T	G	10: 116,510,421	H92P		Het
Col2a1	T	C	15: 97,979,894	D1049G	probably damaging	Het
Creld1	C	T	6: 113,489,767	A237V	probably benign	Het
Csf2rb2	A	T	15: 78,287,087		probably benign	Het
Csmd3	G	A	15: 48,151,605	T643I	probably damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fcmr	A	T	1: 130,874,335	T109S		Het
Grap	C	A	11: 61,671,725	P174Q	possibly damaging	Het
Itgb5	T	A	16: 33,910,456		probably benign	Het
Kidins220	A	G	12: 25,008,079	N561S	probably damaging	Het
Mkl2	T	C	16: 13,400,927	V479A	probably benign	Het
Mri1	A	T	8: 84,257,167	S32T	probably benign	Het
Muc4	A	T	16: 32,751,153	T344S	possibly damaging	Het
Npc1	A	G	18: 12,201,712	I661T	possibly damaging	Het
Npy1r	A	G	8: 66,704,099	N57S	probably damaging	Het
Pds5b	A	G	5: 150,780,721	D863G	probably damaging	Het
Polr2l	A	G	7: 141,473,333	I56T	probably benign	Het
Ppat	A	G	5: 76,916,037	I422T	probably benign	Het
Prkcg	T	A	7: 3,310,608	S110R	possibly damaging	Het
Rab7b	A	T	1: 131,711,802		probably benign	Het
Rnf152	A	T	1: 105,284,526	L102Q		Het
Samd12	A	G	15: 53,719,692	V82A	probably damaging	Het
Serpina1e	T	A	12: 103,951,040	R123S	probably benign	Het
Slit1	T	A	19: 41,627,298	N794I	probably damaging	Het
Surf6	T	C	2: 26,892,994	K154R	probably damaging	Het
Tln2	C	T	9: 67,323,071	A71T	probably benign	Het
Trim3	A	G	7: 105,611,466	Y649H	probably benign	Het
Ttll7	T	A	3: 146,961,742	W808R	probably damaging	Het
Tvp23a	T	C	16: 10,427,423	D104G	probably damaging	Het
Upp2	A	G	2: 58,755,327		probably benign	Het
Vipr1	G	A	9: 121,642,927		probably null	Het
Vmn1r119	A	G	7: 21,012,433	V8A	probably benign	Het
Vmn1r209	T	A	13: 22,806,376	H48L	probably damaging	Het
Wdr11	T	C	7: 129,630,799		probably null	Het
Zcchc17	T	C	4: 130,316,753	D207G	probably damaging	Het
Zfp78	T	C	7: 6,378,943	S331P	probably damaging	Het

Other mutations in Phf14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Phf14	APN	6	11941424	splice site	probably benign
IGL01120:Phf14	APN	6	11962740	missense	probably damaging	1.00
IGL01575:Phf14	APN	6	11990051	missense	probably damaging	1.00
IGL02153:Phf14	APN	6	11934016	missense	probably damaging	0.99
IGL02735:Phf14	APN	6	11987612	missense	probably benign	0.21
IGL03294:Phf14	APN	6	11953367	missense	probably damaging	1.00
IGL03392:Phf14	APN	6	11962659	missense	probably damaging	1.00
G1Funyon:Phf14	UTSW	6	11992062	missense	probably damaging	0.97
R0060:Phf14	UTSW	6	11953317	missense	probably damaging	0.97
R0099:Phf14	UTSW	6	11987697	unclassified	probably benign
R0384:Phf14	UTSW	6	11997020	splice site	probably benign
R0433:Phf14	UTSW	6	11933743	missense	probably damaging	1.00
R0563:Phf14	UTSW	6	11933601	intron	probably benign
R0590:Phf14	UTSW	6	11961578	missense	possibly damaging	0.72
R1066:Phf14	UTSW	6	11987255	missense	possibly damaging	0.47
R1187:Phf14	UTSW	6	11941496	missense	probably damaging	0.97
R1469:Phf14	UTSW	6	11933727	missense	possibly damaging	0.66
R1469:Phf14	UTSW	6	11933727	missense	possibly damaging	0.66
R1491:Phf14	UTSW	6	11941479	missense	possibly damaging	0.80
R1543:Phf14	UTSW	6	11987683	critical splice donor site	probably null
R1595:Phf14	UTSW	6	11988753	missense	possibly damaging	0.69
R1861:Phf14	UTSW	6	11987611	missense	probably benign	0.00
R2289:Phf14	UTSW	6	12047846	missense	probably damaging	1.00
R2437:Phf14	UTSW	6	11962658	missense	probably damaging	1.00
R3831:Phf14	UTSW	6	11933874	splice site	probably null
R3832:Phf14	UTSW	6	11933874	splice site	probably null
R3833:Phf14	UTSW	6	11933874	splice site	probably null
R4290:Phf14	UTSW	6	11987097	missense	probably damaging	1.00
R4293:Phf14	UTSW	6	11987097	missense	probably damaging	1.00
R4294:Phf14	UTSW	6	11987097	missense	probably damaging	1.00
R4295:Phf14	UTSW	6	11987097	missense	probably damaging	1.00
R4572:Phf14	UTSW	6	12006824	missense	probably damaging	1.00
R4663:Phf14	UTSW	6	11953422	missense	possibly damaging	0.92
R4673:Phf14	UTSW	6	11992057	missense	probably damaging	1.00
R4882:Phf14	UTSW	6	11988757	missense	possibly damaging	0.88
R4954:Phf14	UTSW	6	11987620	missense	probably benign	0.09
R5148:Phf14	UTSW	6	11961642	missense	possibly damaging	0.72
R5284:Phf14	UTSW	6	11997120	missense	probably damaging	0.99
R5569:Phf14	UTSW	6	11934016	missense	probably damaging	0.99
R5694:Phf14	UTSW	6	11990125	missense	possibly damaging	0.68
R5726:Phf14	UTSW	6	11933538	intron	probably benign
R5730:Phf14	UTSW	6	11953320	missense	possibly damaging	0.54
R5819:Phf14	UTSW	6	11997252	splice site	probably null
R5915:Phf14	UTSW	6	11933727	missense	possibly damaging	0.66
R6578:Phf14	UTSW	6	11991997	missense	probably damaging	1.00
R6950:Phf14	UTSW	6	12006855	missense	probably damaging	1.00
R7181:Phf14	UTSW	6	11933341	missense	unknown
R7352:Phf14	UTSW	6	11961638	missense	probably damaging	1.00
R7355:Phf14	UTSW	6	12081007	missense	probably benign	0.01
R7947:Phf14	UTSW	6	11933307	missense	unknown
R8110:Phf14	UTSW	6	11953423	missense	possibly damaging	0.91
R8283:Phf14	UTSW	6	11987637	missense	probably benign	0.20
R8301:Phf14	UTSW	6	11992062	missense	probably damaging	0.97
R8688:Phf14	UTSW	6	11990035	missense	probably damaging	0.98
R9402:Phf14	UTSW	6	11933780	missense	possibly damaging	0.49
R9434:Phf14	UTSW	6	11933493	missense	unknown
X0025:Phf14	UTSW	6	11926813	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTATCATTCTCTAGCTATGCTGGG -3'
(R):5'- TGCTTACTGATCAACACTTCTGTAG -3'

Sequencing Primer
(F):5'- AGTTAGGCGTCTTGAGGA -3'
(R):5'- CTGTAGTGTCATAAGCTCAAAAGTC -3'

Posted On

2022-06-15