Incidental Mutation 'R8992:Szt2'
ID 716064
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 068823-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R8992 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 118239985 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075406
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd14b A G 9: 106,328,817 (GRCm39) D146G probably benign Het
Abhd6 T A 14: 8,028,282 (GRCm38) D4E probably benign Het
Atp5if1 T C 4: 132,260,685 (GRCm39) D34G probably benign Het
Bcr T C 10: 74,967,404 (GRCm39) F546S probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc141 A T 2: 76,844,739 (GRCm39) W1443R probably damaging Het
Chd7 A G 4: 8,839,589 (GRCm39) D1375G probably damaging Het
Chi3l1 A T 1: 134,115,662 (GRCm39) Q223H probably benign Het
Clcn2 A T 16: 20,531,080 (GRCm39) F260I probably damaging Het
Cpq A T 15: 33,594,381 (GRCm39) D464V probably benign Het
Crygb T C 1: 65,121,300 (GRCm39) D9G probably damaging Het
Cyp2b10 A G 7: 25,624,815 (GRCm39) K438E unknown Het
Cyp46a1 A T 12: 108,324,366 (GRCm39) D381V possibly damaging Het
Dhx40 A C 11: 86,667,582 (GRCm39) probably benign Het
Dnase2b G T 3: 146,292,717 (GRCm39) P152Q probably damaging Het
Duox1 A T 2: 122,175,186 (GRCm39) H1328L probably damaging Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Fam168b A G 1: 34,858,862 (GRCm39) F102L probably benign Het
Fam3b T A 16: 97,277,594 (GRCm39) D128V probably damaging Het
Galnt11 T G 5: 25,469,983 (GRCm39) H527Q possibly damaging Het
Gbp2b A T 3: 142,316,730 (GRCm39) R460S probably benign Het
Hdhd2 A C 18: 77,058,366 (GRCm39) S246R possibly damaging Het
Heatr1 T C 13: 12,415,995 (GRCm39) M189T probably damaging Het
Ift70a1 A T 2: 75,810,251 (GRCm39) C611S probably benign Het
Ino80 A G 2: 119,210,059 (GRCm39) S1411P possibly damaging Het
Jakmip1 A G 5: 37,274,882 (GRCm39) T467A probably benign Het
Kcnh2 A G 5: 24,536,868 (GRCm39) S239P probably benign Het
Lct T A 1: 128,228,299 (GRCm39) T1065S probably damaging Het
Lrrc66 T C 5: 73,787,227 (GRCm39) D41G probably benign Het
Mfsd2b A T 12: 4,921,490 (GRCm39) D26E probably benign Het
Myh1 A T 11: 67,096,607 (GRCm39) M333L probably benign Het
Neurl4 T C 11: 69,798,958 (GRCm39) V855A possibly damaging Het
Nfkb2 T A 19: 46,295,304 (GRCm39) V80D probably damaging Het
Nop9 T C 14: 55,983,438 (GRCm39) S70P possibly damaging Het
Or2t46 A G 11: 58,471,738 (GRCm39) S23G probably benign Het
Pcdhb14 G T 18: 37,582,231 (GRCm39) D446Y probably damaging Het
Pclo C T 5: 14,719,325 (GRCm39) A1154V unknown Het
Pdgfa G T 5: 138,971,977 (GRCm39) Q141K probably damaging Het
Plekhh1 G T 12: 79,122,307 (GRCm39) L1133F probably damaging Het
Pole A T 5: 110,471,488 (GRCm39) N1411Y possibly damaging Het
Primpol A G 8: 47,034,597 (GRCm39) probably benign Het
Psmc5 T G 11: 106,152,787 (GRCm39) V203G probably damaging Het
Ptgdr C T 14: 45,096,181 (GRCm39) C177Y probably damaging Het
Ptgir A T 7: 16,641,220 (GRCm39) I171F probably damaging Het
Ptprg T A 14: 12,154,170 (GRCm38) H630Q probably benign Het
Ptrh2 A G 11: 86,580,907 (GRCm39) T175A possibly damaging Het
Ralgapb A G 2: 158,296,197 (GRCm39) T857A probably damaging Het
Rnf24 A G 2: 131,155,197 (GRCm39) F10S possibly damaging Het
Rreb1 C A 13: 38,114,352 (GRCm39) S570R probably benign Het
Rttn A G 18: 88,995,832 (GRCm39) N205S probably benign Het
Rusc1 T C 3: 88,999,365 (GRCm39) E139G probably benign Het
Scn2a A G 2: 65,594,242 (GRCm39) N1697S probably damaging Het
Serpinb3a T A 1: 106,974,907 (GRCm39) M209L probably damaging Het
Shank3 A G 15: 89,432,888 (GRCm39) D1211G possibly damaging Het
Slc22a12 C A 19: 6,592,514 (GRCm39) R90L possibly damaging Het
Slc6a13 G A 6: 121,313,901 (GRCm39) W548* probably null Het
Srfbp1 T A 18: 52,609,392 (GRCm39) L59* probably null Het
Ss18 A T 18: 14,803,380 (GRCm39) S73T probably damaging Het
Syne1 T C 10: 5,135,508 (GRCm39) K189R probably benign Het
Tbx1 T A 16: 18,402,937 (GRCm39) H183L probably damaging Het
Thop1 A G 10: 80,915,972 (GRCm39) E385G possibly damaging Het
Tmem168 C A 6: 13,602,849 (GRCm39) M172I possibly damaging Het
Tmem67 A G 4: 12,058,559 (GRCm39) Y513H probably damaging Het
Top1 A G 2: 160,562,921 (GRCm39) D709G probably damaging Het
Tprg1l A C 4: 154,242,890 (GRCm39) S247A probably damaging Het
Trim46 A G 3: 89,143,692 (GRCm39) S602P probably damaging Het
Ttc7b T C 12: 100,466,433 (GRCm39) K60E probably benign Het
Ttn G A 2: 76,714,815 (GRCm39) S8053F unknown Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Usp24 T A 4: 106,234,762 (GRCm39) H956Q probably benign Het
Vcp T C 4: 42,980,828 (GRCm39) T761A probably benign Het
Xpc G A 6: 91,477,956 (GRCm39) T309I possibly damaging Het
Zfp560 C T 9: 20,260,895 (GRCm39) M129I probably benign Het
Zpld2 G A 4: 133,929,978 (GRCm39) T109I probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGTATCCTGACGATGAGC -3'
(R):5'- TAGTCGGGGACTAAGCCTCATG -3'

Sequencing Primer
(F):5'- TATCCTGACGATGAGCCAGAAGTC -3'
(R):5'- TCATGTCCAGTCAAGGCAGTG -3'
Posted On 2022-07-15