Mutagenetix > Incidental Mutation

Incidental Mutation 'R8992:Szt2'

716064

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R8992 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 118382788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000075406

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd14b	A	G	9: 106,451,618	D146G	probably benign	Het
Abhd6	T	A	14: 8,028,282	D4E	probably benign	Het
Atpif1	T	C	4: 132,533,374	D34G	probably benign	Het
Bcr	T	C	10: 75,131,572	F546S	probably damaging	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Ccdc141	A	T	2: 77,014,395	W1443R	probably damaging	Het
Chd7	A	G	4: 8,839,589	D1375G	probably damaging	Het
Chil1	A	T	1: 134,187,924	Q223H	probably benign	Het
Clcn2	A	T	16: 20,712,330	F260I	probably damaging	Het
Cpq	A	T	15: 33,594,235	D464V	probably benign	Het
Crygb	T	C	1: 65,082,141	D9G	probably damaging	Het
Cyp2b10	A	G	7: 25,925,390	K438E	unknown	Het
Cyp46a1	A	T	12: 108,358,107	D381V	possibly damaging	Het
Dhx40	A	C	11: 86,776,756		probably benign	Het
Dnase2b	G	T	3: 146,586,962	P152Q	probably damaging	Het
Duox1	A	T	2: 122,344,705	H1328L	probably damaging	Het
Ephb6	C	T	6: 41,613,359	A15V	probably benign	Het
Fam168b	A	G	1: 34,819,781	F102L	probably benign	Het
Fam3b	T	A	16: 97,476,394	D128V	probably damaging	Het
Galnt11	T	G	5: 25,264,985	H527Q	possibly damaging	Het
Gbp2b	A	T	3: 142,610,969	R460S	probably benign	Het
Gm7534	G	A	4: 134,202,667	T109I	probably damaging	Het
Hdhd2	A	C	18: 76,970,670	S246R	possibly damaging	Het
Heatr1	T	C	13: 12,401,114	M189T	probably damaging	Het
Ino80	A	G	2: 119,379,578	S1411P	possibly damaging	Het
Jakmip1	A	G	5: 37,117,538	T467A	probably benign	Het
Kcnh2	A	G	5: 24,331,870	S239P	probably benign	Het
Lct	T	A	1: 128,300,562	T1065S	probably damaging	Het
Lrrc66	T	C	5: 73,629,884	D41G	probably benign	Het
Mfsd2b	A	T	12: 4,871,490	D26E	probably benign	Het
Myh1	A	T	11: 67,205,781	M333L	probably benign	Het
Neurl4	T	C	11: 69,908,132	V855A	possibly damaging	Het
Nfkb2	T	A	19: 46,306,865	V80D	probably damaging	Het
Nop9	T	C	14: 55,745,981	S70P	possibly damaging	Het
Olfr325	A	G	11: 58,580,912	S23G	probably benign	Het
Pcdhb14	G	T	18: 37,449,178	D446Y	probably damaging	Het
Pclo	C	T	5: 14,669,311	A1154V	unknown	Het
Pdgfa	G	T	5: 138,986,222	Q141K	probably damaging	Het
Plekhh1	G	T	12: 79,075,533	L1133F	probably damaging	Het
Pole	A	T	5: 110,323,622	N1411Y	possibly damaging	Het
Primpol	A	G	8: 46,581,562		probably benign	Het
Psmc5	T	G	11: 106,261,961	V203G	probably damaging	Het
Ptgdr	C	T	14: 44,858,724	C177Y	probably damaging	Het
Ptgir	A	T	7: 16,907,295	I171F	probably damaging	Het
Ptprg	T	A	14: 12,154,170	H630Q	probably benign	Het
Ptrh2	A	G	11: 86,690,081	T175A	possibly damaging	Het
Ralgapb	A	G	2: 158,454,277	T857A	probably damaging	Het
Rnf24	A	G	2: 131,313,277	F10S	possibly damaging	Het
Rreb1	C	A	13: 37,930,376	S570R	probably benign	Het
Rttn	A	G	18: 88,977,708	N205S	probably benign	Het
Rusc1	T	C	3: 89,092,058	E139G	probably benign	Het
Scn2a	A	G	2: 65,763,898	N1697S	probably damaging	Het
Serpinb3a	T	A	1: 107,047,177	M209L	probably damaging	Het
Shank3	A	G	15: 89,548,685	D1211G	possibly damaging	Het
Slc22a12	C	A	19: 6,542,484	R90L	possibly damaging	Het
Slc6a13	G	A	6: 121,336,942	W548*	probably null	Het
Srfbp1	T	A	18: 52,476,320	L59*	probably null	Het
Ss18	A	T	18: 14,670,323	S73T	probably damaging	Het
Syne1	T	C	10: 5,185,508	K189R	probably benign	Het
Tbx1	T	A	16: 18,584,187	H183L	probably damaging	Het
Thop1	A	G	10: 81,080,138	E385G	possibly damaging	Het
Tmem168	C	A	6: 13,602,850	M172I	possibly damaging	Het
Tmem67	A	G	4: 12,058,559	Y513H	probably damaging	Het
Top1	A	G	2: 160,721,001	D709G	probably damaging	Het
Tprgl	A	C	4: 154,158,433	S247A	probably damaging	Het
Trim46	A	G	3: 89,236,385	S602P	probably damaging	Het
Ttc30a1	A	T	2: 75,979,907	C611S	probably benign	Het
Ttc7b	T	C	12: 100,500,174	K60E	probably benign	Het
Ttn	G	A	2: 76,884,471	S8053F	unknown	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Usp24	T	A	4: 106,377,565	H956Q	probably benign	Het
Vcp	T	C	4: 42,980,828	T761A	probably benign	Het
Xpc	G	A	6: 91,500,974	T309I	possibly damaging	Het
Zfp560	C	T	9: 20,349,599	M129I	probably benign	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCAGTATCCTGACGATGAGC -3'
(R):5'- TAGTCGGGGACTAAGCCTCATG -3'

Sequencing Primer
(F):5'- TATCCTGACGATGAGCCAGAAGTC -3'
(R):5'- TCATGTCCAGTCAAGGCAGTG -3'

Posted On

2022-07-15