Incidental Mutation 'R8992:Primpol'
ID 716065
Institutional Source Beutler Lab
Gene Symbol Primpol
Ensembl Gene ENSMUSG00000038225
Gene Name primase and polymerase (DNA-directed)
Synonyms Ccdc111
MMRRC Submission 068823-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8992 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 47028629-47070247 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 47034597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034045] [ENSMUST00000040468] [ENSMUST00000093518] [ENSMUST00000135432] [ENSMUST00000136335] [ENSMUST00000209787] [ENSMUST00000211400]
AlphaFold Q6P1E7
Predicted Effect probably benign
Transcript: ENSMUST00000034045
SMART Domains Protein: ENSMUSP00000034045
Gene: ENSMUSG00000031629

DomainStartEndE-ValueType
low complexity region 58 66 N/A INTRINSIC
Pfam:CENP-U 138 312 6.5e-74 PFAM
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040468
SMART Domains Protein: ENSMUSP00000036119
Gene: ENSMUSG00000038225

DomainStartEndE-ValueType
Pfam:Herpes_UL52 384 448 1.3e-19 PFAM
low complexity region 465 478 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093518
SMART Domains Protein: ENSMUSP00000091239
Gene: ENSMUSG00000031629

DomainStartEndE-ValueType
Pfam:CENP-U 39 162 4.6e-61 PFAM
low complexity region 190 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135432
Predicted Effect probably benign
Transcript: ENSMUST00000136335
Predicted Effect probably benign
Transcript: ENSMUST00000209787
Predicted Effect probably benign
Transcript: ENSMUST00000211400
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA primase-polymerase that belongs to a superfamily of archaeao-eukaryotic primases. Members of this family have primase activity, catalyzing the synthesis of short RNA primers that serve as starting points for DNA synthesis, as well as DNA polymerase activity. The encoded protein facilitates DNA damage tolerance by mediating uninterrupted fork progression after UV irradiation and reinitiating DNA synthesis. An allelic variant in this gene is associated with myopia 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mutants are viable and fertile. Mice homozygous for another knock-out allele exhibit selective increase in C to G transversions in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd14b A G 9: 106,328,817 (GRCm39) D146G probably benign Het
Abhd6 T A 14: 8,028,282 (GRCm38) D4E probably benign Het
Atp5if1 T C 4: 132,260,685 (GRCm39) D34G probably benign Het
Bcr T C 10: 74,967,404 (GRCm39) F546S probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc141 A T 2: 76,844,739 (GRCm39) W1443R probably damaging Het
Chd7 A G 4: 8,839,589 (GRCm39) D1375G probably damaging Het
Chi3l1 A T 1: 134,115,662 (GRCm39) Q223H probably benign Het
Clcn2 A T 16: 20,531,080 (GRCm39) F260I probably damaging Het
Cpq A T 15: 33,594,381 (GRCm39) D464V probably benign Het
Crygb T C 1: 65,121,300 (GRCm39) D9G probably damaging Het
Cyp2b10 A G 7: 25,624,815 (GRCm39) K438E unknown Het
Cyp46a1 A T 12: 108,324,366 (GRCm39) D381V possibly damaging Het
Dhx40 A C 11: 86,667,582 (GRCm39) probably benign Het
Dnase2b G T 3: 146,292,717 (GRCm39) P152Q probably damaging Het
Duox1 A T 2: 122,175,186 (GRCm39) H1328L probably damaging Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Fam168b A G 1: 34,858,862 (GRCm39) F102L probably benign Het
Fam3b T A 16: 97,277,594 (GRCm39) D128V probably damaging Het
Galnt11 T G 5: 25,469,983 (GRCm39) H527Q possibly damaging Het
Gbp2b A T 3: 142,316,730 (GRCm39) R460S probably benign Het
Hdhd2 A C 18: 77,058,366 (GRCm39) S246R possibly damaging Het
Heatr1 T C 13: 12,415,995 (GRCm39) M189T probably damaging Het
Ift70a1 A T 2: 75,810,251 (GRCm39) C611S probably benign Het
Ino80 A G 2: 119,210,059 (GRCm39) S1411P possibly damaging Het
Jakmip1 A G 5: 37,274,882 (GRCm39) T467A probably benign Het
Kcnh2 A G 5: 24,536,868 (GRCm39) S239P probably benign Het
Lct T A 1: 128,228,299 (GRCm39) T1065S probably damaging Het
Lrrc66 T C 5: 73,787,227 (GRCm39) D41G probably benign Het
Mfsd2b A T 12: 4,921,490 (GRCm39) D26E probably benign Het
Myh1 A T 11: 67,096,607 (GRCm39) M333L probably benign Het
Neurl4 T C 11: 69,798,958 (GRCm39) V855A possibly damaging Het
Nfkb2 T A 19: 46,295,304 (GRCm39) V80D probably damaging Het
Nop9 T C 14: 55,983,438 (GRCm39) S70P possibly damaging Het
Or2t46 A G 11: 58,471,738 (GRCm39) S23G probably benign Het
Pcdhb14 G T 18: 37,582,231 (GRCm39) D446Y probably damaging Het
Pclo C T 5: 14,719,325 (GRCm39) A1154V unknown Het
Pdgfa G T 5: 138,971,977 (GRCm39) Q141K probably damaging Het
Plekhh1 G T 12: 79,122,307 (GRCm39) L1133F probably damaging Het
Pole A T 5: 110,471,488 (GRCm39) N1411Y possibly damaging Het
Psmc5 T G 11: 106,152,787 (GRCm39) V203G probably damaging Het
Ptgdr C T 14: 45,096,181 (GRCm39) C177Y probably damaging Het
Ptgir A T 7: 16,641,220 (GRCm39) I171F probably damaging Het
Ptprg T A 14: 12,154,170 (GRCm38) H630Q probably benign Het
Ptrh2 A G 11: 86,580,907 (GRCm39) T175A possibly damaging Het
Ralgapb A G 2: 158,296,197 (GRCm39) T857A probably damaging Het
Rnf24 A G 2: 131,155,197 (GRCm39) F10S possibly damaging Het
Rreb1 C A 13: 38,114,352 (GRCm39) S570R probably benign Het
Rttn A G 18: 88,995,832 (GRCm39) N205S probably benign Het
Rusc1 T C 3: 88,999,365 (GRCm39) E139G probably benign Het
Scn2a A G 2: 65,594,242 (GRCm39) N1697S probably damaging Het
Serpinb3a T A 1: 106,974,907 (GRCm39) M209L probably damaging Het
Shank3 A G 15: 89,432,888 (GRCm39) D1211G possibly damaging Het
Slc22a12 C A 19: 6,592,514 (GRCm39) R90L possibly damaging Het
Slc6a13 G A 6: 121,313,901 (GRCm39) W548* probably null Het
Srfbp1 T A 18: 52,609,392 (GRCm39) L59* probably null Het
Ss18 A T 18: 14,803,380 (GRCm39) S73T probably damaging Het
Syne1 T C 10: 5,135,508 (GRCm39) K189R probably benign Het
Szt2 G T 4: 118,239,985 (GRCm39) probably benign Het
Tbx1 T A 16: 18,402,937 (GRCm39) H183L probably damaging Het
Thop1 A G 10: 80,915,972 (GRCm39) E385G possibly damaging Het
Tmem168 C A 6: 13,602,849 (GRCm39) M172I possibly damaging Het
Tmem67 A G 4: 12,058,559 (GRCm39) Y513H probably damaging Het
Top1 A G 2: 160,562,921 (GRCm39) D709G probably damaging Het
Tprg1l A C 4: 154,242,890 (GRCm39) S247A probably damaging Het
Trim46 A G 3: 89,143,692 (GRCm39) S602P probably damaging Het
Ttc7b T C 12: 100,466,433 (GRCm39) K60E probably benign Het
Ttn G A 2: 76,714,815 (GRCm39) S8053F unknown Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Usp24 T A 4: 106,234,762 (GRCm39) H956Q probably benign Het
Vcp T C 4: 42,980,828 (GRCm39) T761A probably benign Het
Xpc G A 6: 91,477,956 (GRCm39) T309I possibly damaging Het
Zfp560 C T 9: 20,260,895 (GRCm39) M129I probably benign Het
Zpld2 G A 4: 133,929,978 (GRCm39) T109I probably damaging Het
Other mutations in Primpol
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Primpol APN 8 47,034,632 (GRCm39) missense probably damaging 0.98
IGL02421:Primpol APN 8 47,060,830 (GRCm39) splice site probably benign
IGL02886:Primpol APN 8 47,046,619 (GRCm39) nonsense probably null
IGL03244:Primpol APN 8 47,039,475 (GRCm39) missense probably damaging 1.00
R0243:Primpol UTSW 8 47,052,849 (GRCm39) missense probably damaging 1.00
R0329:Primpol UTSW 8 47,063,496 (GRCm39) missense probably damaging 0.97
R0330:Primpol UTSW 8 47,063,496 (GRCm39) missense probably damaging 0.97
R0571:Primpol UTSW 8 47,034,674 (GRCm39) missense probably damaging 1.00
R1266:Primpol UTSW 8 47,046,734 (GRCm39) missense probably damaging 1.00
R1334:Primpol UTSW 8 47,039,426 (GRCm39) missense probably damaging 1.00
R1469:Primpol UTSW 8 47,046,672 (GRCm39) missense probably benign
R1469:Primpol UTSW 8 47,046,672 (GRCm39) missense probably benign
R1524:Primpol UTSW 8 47,039,502 (GRCm39) intron probably benign
R1738:Primpol UTSW 8 47,060,873 (GRCm39) missense probably damaging 0.98
R2144:Primpol UTSW 8 47,039,378 (GRCm39) missense probably damaging 0.99
R3747:Primpol UTSW 8 47,052,848 (GRCm39) missense probably benign 0.34
R3748:Primpol UTSW 8 47,052,848 (GRCm39) missense probably benign 0.34
R3750:Primpol UTSW 8 47,052,848 (GRCm39) missense probably benign 0.34
R4378:Primpol UTSW 8 47,029,218 (GRCm39) utr 3 prime probably benign
R4855:Primpol UTSW 8 47,039,726 (GRCm39) missense probably benign 0.00
R5209:Primpol UTSW 8 47,043,295 (GRCm39) missense probably benign 0.00
R5497:Primpol UTSW 8 47,045,657 (GRCm39) nonsense probably null
R5720:Primpol UTSW 8 47,034,677 (GRCm39) missense probably damaging 1.00
R5963:Primpol UTSW 8 47,046,615 (GRCm39) missense possibly damaging 0.93
R6164:Primpol UTSW 8 47,039,477 (GRCm39) missense probably benign 0.10
R6497:Primpol UTSW 8 47,039,376 (GRCm39) critical splice donor site probably null
R6549:Primpol UTSW 8 47,058,185 (GRCm39) missense probably damaging 1.00
R7595:Primpol UTSW 8 47,063,650 (GRCm39) missense probably benign 0.00
R7775:Primpol UTSW 8 47,039,459 (GRCm39) missense probably damaging 1.00
R7778:Primpol UTSW 8 47,039,459 (GRCm39) missense probably damaging 1.00
R7824:Primpol UTSW 8 47,039,459 (GRCm39) missense probably damaging 1.00
R8055:Primpol UTSW 8 47,032,197 (GRCm39) missense probably benign 0.34
R8840:Primpol UTSW 8 47,046,731 (GRCm39) missense probably damaging 1.00
R9356:Primpol UTSW 8 47,043,318 (GRCm39) missense probably benign 0.00
R9388:Primpol UTSW 8 47,034,605 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTCACAGTGTGCTAAAGGCTATC -3'
(R):5'- TCCATCTTAGGCACATCTCCGG -3'

Sequencing Primer
(F):5'- TGTGCTAAAGGCTATCTAGAGGC -3'
(R):5'- TCCGGCACATGGCTATAGTTAAC -3'
Posted On 2022-07-15