Incidental Mutation 'R9479:Olfr835'
ID 716127
Institutional Source Beutler Lab
Gene Symbol Olfr835
Ensembl Gene ENSMUSG00000045204
Gene Name olfactory receptor 835
Synonyms MOR150-3, GA_x6K02T2PVTD-12771995-12772930
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock # R9479 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 19032735-19037670 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 19035434 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 104 (V104I)
Ref Sequence ENSEMBL: ENSMUSP00000148416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059315] [ENSMUST00000213018]
AlphaFold Q7TRG7
Predicted Effect probably benign
Transcript: ENSMUST00000059315
AA Change: V104I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052610
Gene: ENSMUSG00000045204
AA Change: V104I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 206 2.9e-7 PFAM
Pfam:7tm_1 41 303 1.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213018
AA Change: V104I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox3 A G 1: 58,138,409 Y261C probably benign Het
Arhgef10 T C 8: 14,997,632 V1165A probably damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Bhmt2 G A 13: 93,663,325 A201V probably damaging Het
Ccdc115 A T 1: 34,437,814 S115T possibly damaging Het
Clca4b A G 3: 144,911,339 V850A probably benign Het
Commd8 A T 5: 72,161,007 H144Q probably benign Het
Creb3l1 C T 2: 91,991,886 probably null Het
Csnka2ip T C 16: 64,477,899 K701E unknown Het
Cyb5d2 A G 11: 72,778,876 C219R Het
Ep400 T C 5: 110,729,864 T835A unknown Het
Fam169a A G 13: 97,110,035 Y228C possibly damaging Het
Fam169a A G 13: 97,114,187 D342G possibly damaging Het
Fbxw21 A T 9: 109,139,544 C455S probably benign Het
Fbxw26 A G 9: 109,732,557 S190P probably damaging Het
Gabra5 A G 7: 57,408,692 I436T Het
Gm9767 G A 10: 26,079,018 G156D Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Gsn T C 2: 35,296,215 probably null Het
Hao1 A G 2: 134,554,284 S17P probably benign Het
Hspa1l A G 17: 34,977,759 N258S probably benign Het
Isyna1 C T 8: 70,595,543 R200C probably damaging Het
Itgb2 A T 10: 77,561,108 K659M probably benign Het
Klf11 T C 12: 24,655,030 M161T probably benign Het
Ktn1 A T 14: 47,724,717 K1114N probably damaging Het
Lonrf1 G A 8: 36,230,514 R439* probably null Het
Lrrc26 C T 2: 25,290,559 P191S probably benign Het
Ogdh T C 11: 6,347,854 I576T possibly damaging Het
Olfr115 A G 17: 37,609,827 F308S probably damaging Het
Olfr1181 T C 2: 88,423,333 R231G probably damaging Het
Olfr120 T C 17: 37,726,095 S24P probably damaging Het
Olfr1286 A T 2: 111,420,668 F94L probably damaging Het
Olfr297 T C 7: 86,527,077 C107R possibly damaging Het
Pcnt A G 10: 76,382,129 V2104A probably benign Het
Pds5a G A 5: 65,635,404 R729W probably damaging Het
Pgap1 G A 1: 54,543,116 Q191* probably null Het
Pglyrp3 A G 3: 92,028,003 I187V probably benign Het
Pkdrej T A 15: 85,815,370 I2122F possibly damaging Het
Pold1 G A 7: 44,541,655 R251W probably damaging Het
Prr22 A G 17: 56,771,335 M163V probably benign Het
Ptprc A T 1: 138,073,650 N814K probably benign Het
Rapgef2 G A 3: 79,112,188 L59F probably damaging Het
Rbm22 T C 18: 60,566,420 L147P probably damaging Het
Rgsl1 G A 1: 153,781,699 S391F unknown Het
Rnf13 A T 3: 57,820,562 D221V possibly damaging Het
Senp2 T A 16: 22,023,648 L154Q probably damaging Het
Srfbp1 A G 18: 52,488,260 Q131R possibly damaging Het
Tmprss11a A T 5: 86,414,543 Y314* probably null Het
Ttn G T 2: 76,835,942 P11590Q unknown Het
Txnrd3 C T 6: 89,663,102 T266M possibly damaging Het
Zfp810 T C 9: 22,283,201 S64G possibly damaging Het
Other mutations in Olfr835
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Olfr835 APN 9 19035288 nonsense probably null
IGL02546:Olfr835 APN 9 19035354 missense possibly damaging 0.88
R0010:Olfr835 UTSW 9 19035322 missense probably damaging 1.00
R0107:Olfr835 UTSW 9 19035333 missense probably damaging 1.00
R1867:Olfr835 UTSW 9 19035266 missense probably benign 0.36
R1891:Olfr835 UTSW 9 19035978 missense probably damaging 0.99
R1941:Olfr835 UTSW 9 19035866 missense possibly damaging 0.93
R4152:Olfr835 UTSW 9 19035520 nonsense probably null
R5451:Olfr835 UTSW 9 19035491 missense probably damaging 1.00
R5677:Olfr835 UTSW 9 19035558 missense possibly damaging 0.93
R5970:Olfr835 UTSW 9 19035147 missense probably benign
R6187:Olfr835 UTSW 9 19035393 missense probably benign 0.12
R6805:Olfr835 UTSW 9 19035301 missense probably damaging 1.00
R7183:Olfr835 UTSW 9 19035332 missense probably damaging 1.00
R8029:Olfr835 UTSW 9 19035794 missense probably damaging 1.00
R8139:Olfr835 UTSW 9 19035575 missense probably benign 0.07
R8736:Olfr835 UTSW 9 19035478 missense probably damaging 1.00
R8868:Olfr835 UTSW 9 19035482 missense probably damaging 1.00
R8909:Olfr835 UTSW 9 19035592 missense probably benign 0.08
R9116:Olfr835 UTSW 9 19035477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACATGGTCACCATCTTGGG -3'
(R):5'- GGGATCTCTAGATTTGTGCAGAAAG -3'

Sequencing Primer
(F):5'- CATGGTCACCATCTTGGGAAATCTG -3'
(R):5'- GTCTTAATACCATGAGACCAAGAAG -3'
Posted On 2022-07-18