Incidental Mutation 'R9481:Stk32c'
ID 716247
Institutional Source Beutler Lab
Gene Symbol Stk32c
Ensembl Gene ENSMUSG00000015981
Gene Name serine/threonine kinase 32C
Synonyms Pkek, YANK3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9481 (G1)
Quality Score 189.009
Status Not validated
Chromosome 7
Chromosomal Location 138683554-138793223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 138768173 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 36 (P36L)
Ref Sequence ENSEMBL: ENSMUSP00000016125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000165870]
AlphaFold Q8QZV4
Predicted Effect unknown
Transcript: ENSMUST00000016125
AA Change: P36L
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981
AA Change: P36L

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165870
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. It is thought that this family member is functional in brain due to its high expression levels there. DNA methylation differences have been found in this gene in monozygotic twins that are discordant for adolescent depression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Acsf2 C T 11: 94,464,044 (GRCm39) V47M probably benign Het
Ahcyl1 A T 3: 107,579,388 (GRCm39) C215* probably null Het
Ambn G T 5: 88,613,050 (GRCm39) probably null Het
Apol9b G T 15: 77,619,656 (GRCm39) V151L probably benign Het
Arid1b A G 17: 5,369,007 (GRCm39) Y1070C probably damaging Het
Arnt T C 3: 95,391,092 (GRCm39) L322P possibly damaging Het
Bdnf A G 2: 109,553,935 (GRCm39) D103G possibly damaging Het
Ccdc9 A T 7: 16,016,761 (GRCm39) D42E probably damaging Het
Cdh13 A G 8: 119,963,676 (GRCm39) T419A Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Clasp2 A T 9: 113,670,669 (GRCm39) R329W probably damaging Het
Csmd3 A G 15: 47,470,459 (GRCm39) C2495R Het
Cyba A T 8: 123,154,394 (GRCm39) I43N possibly damaging Het
Cyp2a5 A C 7: 26,540,511 (GRCm39) T375P possibly damaging Het
Cyp2r1 A G 7: 114,152,369 (GRCm39) F196S probably damaging Het
Efcab2 T C 1: 178,308,887 (GRCm39) F130S probably damaging Het
Eml6 T G 11: 29,788,641 (GRCm39) probably null Het
Fbln5 A T 12: 101,734,728 (GRCm39) C181* probably null Het
Glyatl3 A G 17: 41,221,016 (GRCm39) V117A probably benign Het
Gpc6 A G 14: 117,163,432 (GRCm39) S29G probably benign Het
Hadhb T G 5: 30,368,711 (GRCm39) S13A probably benign Het
Hook1 C T 4: 95,901,505 (GRCm39) R488C probably damaging Het
Icam5 A G 9: 20,948,877 (GRCm39) Y743C probably damaging Het
Il15ra T C 2: 11,724,854 (GRCm39) V108A probably benign Het
Itga1 T C 13: 115,152,753 (GRCm39) N223S probably benign Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,712,417 (GRCm39) probably benign Het
Kcnk1 T C 8: 126,756,281 (GRCm39) C268R probably damaging Het
Kctd19 A T 8: 106,120,249 (GRCm39) L264M probably benign Het
Kmt2c A T 5: 25,554,860 (GRCm39) I1258K probably benign Het
Kmt2c A T 5: 25,497,907 (GRCm39) D3949E probably damaging Het
Lyst G A 13: 13,857,653 (GRCm39) E2481K possibly damaging Het
Megf10 T A 18: 57,395,090 (GRCm39) I484N probably benign Het
Mettl21e T C 1: 44,245,857 (GRCm39) I130V probably benign Het
Nmnat2 C A 1: 152,962,181 (GRCm39) N140K possibly damaging Het
Nsmaf T C 4: 6,414,976 (GRCm39) K630R probably benign Het
Or2t1 C T 14: 14,328,756 (GRCm38) S215L probably benign Het
Or5w15 A T 2: 87,568,576 (GRCm39) F31I probably benign Het
Or8b38 G T 9: 37,972,707 (GRCm39) L30F probably benign Het
Or8g26 T C 9: 39,096,172 (GRCm39) S230P possibly damaging Het
Pafah1b2 G A 9: 45,884,284 (GRCm39) Q123* probably null Het
Ptprb T A 10: 116,155,353 (GRCm39) N415K probably benign Het
Rev3l T A 10: 39,701,033 (GRCm39) D1843E probably benign Het
Rps6ka4 T A 19: 6,809,372 (GRCm39) R427S possibly damaging Het
Scgb2b24 A T 7: 33,436,795 (GRCm39) L106I probably benign Het
Skint9 A T 4: 112,248,915 (GRCm39) M171K probably benign Het
Spata17 A G 1: 186,844,756 (GRCm39) V281A possibly damaging Het
Spef1 A T 2: 131,014,625 (GRCm39) V99E probably damaging Het
Srpra C T 9: 35,126,015 (GRCm39) T431I probably damaging Het
Taar7d T C 10: 23,903,739 (GRCm39) I207T probably benign Het
Tle1 G A 4: 72,044,504 (GRCm39) T501I probably damaging Het
Tmem88b A T 4: 155,868,733 (GRCm39) W172R probably damaging Het
Usp48 G A 4: 137,340,996 (GRCm39) G332E probably benign Het
Vcl G T 14: 21,070,726 (GRCm39) V771L probably benign Het
Vmn1r200 T A 13: 22,579,911 (GRCm39) M238K probably damaging Het
Vmn2r96 A G 17: 18,793,621 (GRCm39) probably benign Het
Vsig10l G T 7: 43,112,795 (GRCm39) E18* probably null Het
Wdfy3 A G 5: 102,000,478 (GRCm39) L2964P probably benign Het
Zfp334 G A 2: 165,222,271 (GRCm39) R591W probably damaging Het
Zpld2 G A 4: 133,929,312 (GRCm39) P331L probably benign Het
Other mutations in Stk32c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Stk32c APN 7 138,768,069 (GRCm39) missense possibly damaging 0.47
IGL02559:Stk32c APN 7 138,700,606 (GRCm39) missense probably benign 0.00
IGL02805:Stk32c APN 7 138,701,762 (GRCm39) missense probably damaging 1.00
R0531:Stk32c UTSW 7 138,700,636 (GRCm39) missense probably damaging 0.97
R0622:Stk32c UTSW 7 138,768,026 (GRCm39) missense probably benign 0.00
R1140:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1473:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1589:Stk32c UTSW 7 138,698,931 (GRCm39) critical splice donor site probably null
R1697:Stk32c UTSW 7 138,701,740 (GRCm39) missense probably benign 0.25
R1855:Stk32c UTSW 7 138,701,363 (GRCm39) missense probably damaging 0.97
R4290:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4293:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4295:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R5323:Stk32c UTSW 7 138,699,276 (GRCm39) missense probably benign 0.07
R5854:Stk32c UTSW 7 138,768,195 (GRCm39) intron probably benign
R5907:Stk32c UTSW 7 138,700,590 (GRCm39) missense probably benign 0.32
R6115:Stk32c UTSW 7 138,700,628 (GRCm39) nonsense probably null
R6117:Stk32c UTSW 7 138,702,839 (GRCm39) nonsense probably null
R6176:Stk32c UTSW 7 138,700,691 (GRCm39) missense probably benign 0.02
R6460:Stk32c UTSW 7 138,685,190 (GRCm39) missense probably damaging 1.00
R6695:Stk32c UTSW 7 138,702,880 (GRCm39) missense probably damaging 1.00
R6745:Stk32c UTSW 7 138,702,809 (GRCm39) missense probably damaging 0.99
R7177:Stk32c UTSW 7 138,684,218 (GRCm39) missense possibly damaging 0.62
R7676:Stk32c UTSW 7 138,685,220 (GRCm39) missense possibly damaging 0.87
R7721:Stk32c UTSW 7 138,768,069 (GRCm39) missense possibly damaging 0.47
R8977:Stk32c UTSW 7 138,705,161 (GRCm39) missense possibly damaging 0.69
R9004:Stk32c UTSW 7 138,702,859 (GRCm39) missense probably damaging 1.00
R9117:Stk32c UTSW 7 138,768,141 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GTCCCAACGCAGAGAAATGC -3'
(R):5'- AACTAGACCCTTTTCCGCG -3'

Sequencing Primer
(F):5'- TCTCCAGAGGCCCGGGTAC -3'
(R):5'- TGCTGCGCACGGAATCTAATAC -3'
Posted On 2022-07-18