Incidental Mutation 'R9481:Kctd19'
ID 716248
Institutional Source Beutler Lab
Gene Symbol Kctd19
Ensembl Gene ENSMUSG00000051648
Gene Name potassium channel tetramerisation domain containing 19
Synonyms 4922504H04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R9481 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 105382807-105413502 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105393617 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 264 (L264M)
Ref Sequence ENSEMBL: ENSMUSP00000050687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063071] [ENSMUST00000167294] [ENSMUST00000168888]
AlphaFold Q562E2
Predicted Effect probably benign
Transcript: ENSMUST00000063071
AA Change: L264M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648
AA Change: L264M

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000167294
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168888
SMART Domains Protein: ENSMUSP00000131732
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 95 4.3e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Acsf2 C T 11: 94,573,218 V47M probably benign Het
Ahcyl1 A T 3: 107,672,072 C215* probably null Het
Ambn G T 5: 88,465,191 probably null Het
Apol9b G T 15: 77,735,456 V151L probably benign Het
Arid1b A G 17: 5,318,732 Y1070C probably damaging Het
Arnt T C 3: 95,483,781 L322P possibly damaging Het
Bdnf A G 2: 109,723,590 D103G possibly damaging Het
Ccdc9 A T 7: 16,282,836 D42E probably damaging Het
Cdh13 A G 8: 119,236,937 T419A Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clasp2 A T 9: 113,841,601 R329W probably damaging Het
Csmd3 A G 15: 47,607,063 C2495R Het
Cyba A T 8: 122,427,655 I43N possibly damaging Het
Cyp2a5 A C 7: 26,841,086 T375P possibly damaging Het
Cyp2r1 A G 7: 114,553,134 F196S probably damaging Het
Efcab2 T C 1: 178,481,322 F130S probably damaging Het
Eml6 T G 11: 29,838,641 probably null Het
Fbln5 A T 12: 101,768,469 C181* probably null Het
Glyatl3 A G 17: 40,910,125 V117A probably benign Het
Gm7534 G A 4: 134,202,001 P331L probably benign Het
Gpc6 A G 14: 116,926,020 S29G probably benign Het
Hadhb T G 5: 30,163,713 S13A probably benign Het
Hook1 C T 4: 96,013,268 R488C probably damaging Het
Icam5 A G 9: 21,037,581 Y743C probably damaging Het
Il15ra T C 2: 11,720,043 V108A probably benign Het
Itga1 T C 13: 115,016,217 N223S probably benign Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kcnk1 T C 8: 126,029,542 C268R probably damaging Het
Kmt2c A T 5: 25,292,909 D3949E probably damaging Het
Kmt2c A T 5: 25,349,862 I1258K probably benign Het
Lyst G A 13: 13,683,068 E2481K possibly damaging Het
Megf10 T A 18: 57,262,018 I484N probably benign Het
Mettl21e T C 1: 44,206,697 I130V probably benign Het
Nmnat2 C A 1: 153,086,435 N140K possibly damaging Het
Nsmaf T C 4: 6,414,976 K630R probably benign Het
Olfr1138 A T 2: 87,738,232 F31I probably benign Het
Olfr31 C T 14: 14,328,756 S215L probably benign Het
Olfr885 G T 9: 38,061,411 L30F probably benign Het
Olfr943 T C 9: 39,184,876 S230P possibly damaging Het
Pafah1b2 G A 9: 45,972,986 Q123* probably null Het
Ptprb T A 10: 116,319,448 N415K probably benign Het
Rev3l T A 10: 39,825,037 D1843E probably benign Het
Rps6ka4 T A 19: 6,832,004 R427S possibly damaging Het
Scgb2b24 A T 7: 33,737,370 L106I probably benign Het
Skint9 A T 4: 112,391,718 M171K probably benign Het
Spata17 A G 1: 187,112,559 V281A possibly damaging Het
Spef1 A T 2: 131,172,705 V99E probably damaging Het
Srpr C T 9: 35,214,719 T431I probably damaging Het
Stk32c G A 7: 139,188,257 P36L unknown Het
Taar7d T C 10: 24,027,841 I207T probably benign Het
Tle1 G A 4: 72,126,267 T501I probably damaging Het
Tmem88b A T 4: 155,784,276 W172R probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vcl G T 14: 21,020,658 V771L probably benign Het
Vmn1r200 T A 13: 22,395,741 M238K probably damaging Het
Vmn2r96 A G 17: 18,573,359 probably benign Het
Vsig10l G T 7: 43,463,371 E18* probably null Het
Wdfy3 A G 5: 101,852,612 L2964P probably benign Het
Zfp334 G A 2: 165,380,351 R591W probably damaging Het
Other mutations in Kctd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Kctd19 APN 8 105388463 critical splice donor site probably null
IGL01546:Kctd19 APN 8 105386962 missense probably benign
IGL01786:Kctd19 APN 8 105390304 missense probably benign 0.03
IGL01964:Kctd19 APN 8 105388525 missense probably damaging 0.99
IGL02275:Kctd19 APN 8 105396374 missense probably damaging 0.99
IGL02479:Kctd19 APN 8 105384768 missense probably damaging 1.00
IGL03124:Kctd19 APN 8 105387070 missense possibly damaging 0.48
R0003:Kctd19 UTSW 8 105395361 missense probably damaging 0.99
R1183:Kctd19 UTSW 8 105382966 missense probably benign
R1388:Kctd19 UTSW 8 105392051 missense probably null 0.93
R1491:Kctd19 UTSW 8 105387062 missense possibly damaging 0.60
R1517:Kctd19 UTSW 8 105395376 missense probably damaging 1.00
R1540:Kctd19 UTSW 8 105387879 missense probably damaging 0.96
R1582:Kctd19 UTSW 8 105395460 missense probably damaging 1.00
R1964:Kctd19 UTSW 8 105388470 missense probably damaging 0.98
R1996:Kctd19 UTSW 8 105395300 missense probably null 1.00
R2129:Kctd19 UTSW 8 105385172 missense probably damaging 0.98
R2281:Kctd19 UTSW 8 105387266 missense probably benign 0.00
R3767:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R3768:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R4285:Kctd19 UTSW 8 105382949 unclassified probably benign
R4621:Kctd19 UTSW 8 105396471 missense probably damaging 1.00
R4701:Kctd19 UTSW 8 105390429 missense possibly damaging 0.76
R4969:Kctd19 UTSW 8 105396327 splice site probably null
R5070:Kctd19 UTSW 8 105391999 missense probably damaging 1.00
R5401:Kctd19 UTSW 8 105382985 missense probably benign 0.00
R5582:Kctd19 UTSW 8 105408443 missense probably damaging 1.00
R5783:Kctd19 UTSW 8 105386980 missense probably benign
R6056:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6057:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6269:Kctd19 UTSW 8 105395360 missense possibly damaging 0.96
R6273:Kctd19 UTSW 8 105385485 missense probably benign
R6631:Kctd19 UTSW 8 105385328 critical splice donor site probably null
R7298:Kctd19 UTSW 8 105382984 missense probably benign 0.01
R7474:Kctd19 UTSW 8 105392032 missense probably benign 0.25
R7540:Kctd19 UTSW 8 105386935 missense probably benign 0.00
R7923:Kctd19 UTSW 8 105385058 missense probably damaging 1.00
R8059:Kctd19 UTSW 8 105396351 missense probably benign 0.02
R8117:Kctd19 UTSW 8 105395437 missense unknown
R8836:Kctd19 UTSW 8 105385396 missense probably damaging 0.98
R9155:Kctd19 UTSW 8 105393939 missense probably benign 0.01
R9429:Kctd19 UTSW 8 105383020 missense probably damaging 0.98
R9627:Kctd19 UTSW 8 105387365 missense probably benign 0.01
Z1088:Kctd19 UTSW 8 105385335 missense probably benign 0.02
Z1176:Kctd19 UTSW 8 105385136 missense probably damaging 1.00
Z1177:Kctd19 UTSW 8 105388517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGCTAGAAAGTAGGCTCTTC -3'
(R):5'- AACAGTCTGGGCTTGAGCTAC -3'

Sequencing Primer
(F):5'- GCTAGAAAGTAGGCTCTTCATTTCAC -3'
(R):5'- TCTGGGCTTGAGCTACAGAAG -3'
Posted On 2022-07-18