Incidental Mutation 'R9481:Rev3l'
ID 716259
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene Name REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms Sez4, Rev
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9481 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 39732118-39875211 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39825037 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1843 (D1843E)
Ref Sequence ENSEMBL: ENSMUSP00000019986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]
AlphaFold no structure available at present
PDB Structure Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000019986
AA Change: D1843E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: D1843E

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably benign
Transcript: ENSMUST00000139803
SMART Domains Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

DomainStartEndE-ValueType
Blast:POLBc 1 369 1e-155 BLAST
POLBc 434 805 4.77e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164763
AA Change: D1843E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: D1843E

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Acsf2 C T 11: 94,573,218 V47M probably benign Het
Ahcyl1 A T 3: 107,672,072 C215* probably null Het
Ambn G T 5: 88,465,191 probably null Het
Apol9b G T 15: 77,735,456 V151L probably benign Het
Arid1b A G 17: 5,318,732 Y1070C probably damaging Het
Arnt T C 3: 95,483,781 L322P possibly damaging Het
Bdnf A G 2: 109,723,590 D103G possibly damaging Het
Ccdc9 A T 7: 16,282,836 D42E probably damaging Het
Cdh13 A G 8: 119,236,937 T419A Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clasp2 A T 9: 113,841,601 R329W probably damaging Het
Csmd3 A G 15: 47,607,063 C2495R Het
Cyba A T 8: 122,427,655 I43N possibly damaging Het
Cyp2a5 A C 7: 26,841,086 T375P possibly damaging Het
Cyp2r1 A G 7: 114,553,134 F196S probably damaging Het
Efcab2 T C 1: 178,481,322 F130S probably damaging Het
Eml6 T G 11: 29,838,641 probably null Het
Fbln5 A T 12: 101,768,469 C181* probably null Het
Glyatl3 A G 17: 40,910,125 V117A probably benign Het
Gm7534 G A 4: 134,202,001 P331L probably benign Het
Gpc6 A G 14: 116,926,020 S29G probably benign Het
Hadhb T G 5: 30,163,713 S13A probably benign Het
Hook1 C T 4: 96,013,268 R488C probably damaging Het
Icam5 A G 9: 21,037,581 Y743C probably damaging Het
Il15ra T C 2: 11,720,043 V108A probably benign Het
Itga1 T C 13: 115,016,217 N223S probably benign Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kcnk1 T C 8: 126,029,542 C268R probably damaging Het
Kctd19 A T 8: 105,393,617 L264M probably benign Het
Kmt2c A T 5: 25,292,909 D3949E probably damaging Het
Kmt2c A T 5: 25,349,862 I1258K probably benign Het
Lyst G A 13: 13,683,068 E2481K possibly damaging Het
Megf10 T A 18: 57,262,018 I484N probably benign Het
Mettl21e T C 1: 44,206,697 I130V probably benign Het
Nmnat2 C A 1: 153,086,435 N140K possibly damaging Het
Nsmaf T C 4: 6,414,976 K630R probably benign Het
Olfr1138 A T 2: 87,738,232 F31I probably benign Het
Olfr31 C T 14: 14,328,756 S215L probably benign Het
Olfr885 G T 9: 38,061,411 L30F probably benign Het
Olfr943 T C 9: 39,184,876 S230P possibly damaging Het
Pafah1b2 G A 9: 45,972,986 Q123* probably null Het
Ptprb T A 10: 116,319,448 N415K probably benign Het
Rps6ka4 T A 19: 6,832,004 R427S possibly damaging Het
Scgb2b24 A T 7: 33,737,370 L106I probably benign Het
Skint9 A T 4: 112,391,718 M171K probably benign Het
Spata17 A G 1: 187,112,559 V281A possibly damaging Het
Spef1 A T 2: 131,172,705 V99E probably damaging Het
Srpr C T 9: 35,214,719 T431I probably damaging Het
Stk32c G A 7: 139,188,257 P36L unknown Het
Taar7d T C 10: 24,027,841 I207T probably benign Het
Tle1 G A 4: 72,126,267 T501I probably damaging Het
Tmem88b A T 4: 155,784,276 W172R probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vcl G T 14: 21,020,658 V771L probably benign Het
Vmn1r200 T A 13: 22,395,741 M238K probably damaging Het
Vmn2r96 A G 17: 18,573,359 probably benign Het
Vsig10l G T 7: 43,463,371 E18* probably null Het
Wdfy3 A G 5: 101,852,612 L2964P probably benign Het
Zfp334 G A 2: 165,380,351 R591W probably damaging Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39806969 missense probably benign
IGL00815:Rev3l APN 10 39859153 missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39864806 missense probably benign 0.39
IGL01765:Rev3l APN 10 39828265 missense probably benign 0.00
IGL01792:Rev3l APN 10 39823340 missense probably benign
IGL01950:Rev3l APN 10 39821157 missense probably damaging 1.00
IGL01963:Rev3l APN 10 39822737 missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39825099 missense probably damaging 1.00
IGL02288:Rev3l APN 10 39828216 missense probably benign
IGL02381:Rev3l APN 10 39821346 missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39821148 missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39822591 missense probably damaging 1.00
IGL02570:Rev3l APN 10 39848013 missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39821281 missense probably benign 0.10
IGL02654:Rev3l APN 10 39862734 missense probably damaging 1.00
IGL02720:Rev3l APN 10 39822395 nonsense probably null
IGL02746:Rev3l APN 10 39824589 missense probably damaging 0.99
IGL02829:Rev3l APN 10 39825240 missense probably damaging 1.00
IGL02961:Rev3l APN 10 39827945 missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39862747 nonsense probably null
IGL03029:Rev3l APN 10 39828486 missense probably benign 0.34
IGL03153:Rev3l APN 10 39806878 missense probably damaging 1.00
IGL03172:Rev3l APN 10 39824790 missense probably benign 0.10
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39874128 nonsense probably null
R0308:Rev3l UTSW 10 39824894 missense probably benign 0.09
R0355:Rev3l UTSW 10 39817286 missense probably damaging 1.00
R0513:Rev3l UTSW 10 39828143 missense probably benign 0.00
R0523:Rev3l UTSW 10 39848049 missense probably benign 0.02
R0559:Rev3l UTSW 10 39824487 missense probably damaging 1.00
R0761:Rev3l UTSW 10 39874195 missense probably benign 0.32
R1023:Rev3l UTSW 10 39832639 missense probably damaging 1.00
R1159:Rev3l UTSW 10 39851925 nonsense probably null
R1398:Rev3l UTSW 10 39821583 missense probably benign 0.05
R1478:Rev3l UTSW 10 39783333 critical splice donor site probably null
R1517:Rev3l UTSW 10 39838443 missense probably benign 0.34
R1527:Rev3l UTSW 10 39822822 missense probably damaging 1.00
R1635:Rev3l UTSW 10 39806662 missense probably damaging 0.98
R1695:Rev3l UTSW 10 39824615 nonsense probably null
R1695:Rev3l UTSW 10 39824616 missense probably damaging 0.97
R1782:Rev3l UTSW 10 39799885 missense probably benign
R1815:Rev3l UTSW 10 39822871 missense probably benign 0.41
R1818:Rev3l UTSW 10 39828424 missense probably benign 0.05
R2039:Rev3l UTSW 10 39824444 missense probably damaging 1.00
R2071:Rev3l UTSW 10 39824353 missense probably benign 0.17
R2101:Rev3l UTSW 10 39828096 missense probably benign 0.00
R2141:Rev3l UTSW 10 39848049 missense probably benign 0.02
R2883:Rev3l UTSW 10 39825156 missense probably damaging 1.00
R3787:Rev3l UTSW 10 39846210 missense probably damaging 0.97
R3910:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3912:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3913:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R4590:Rev3l UTSW 10 39806933 missense probably damaging 1.00
R4631:Rev3l UTSW 10 39828416 missense probably benign 0.44
R4633:Rev3l UTSW 10 39846186 missense probably damaging 1.00
R4707:Rev3l UTSW 10 39823397 missense probably damaging 0.99
R4724:Rev3l UTSW 10 39846806 nonsense probably null
R4810:Rev3l UTSW 10 39823725 missense probably benign 0.01
R4857:Rev3l UTSW 10 39838459 missense probably damaging 1.00
R4882:Rev3l UTSW 10 39821460 missense possibly damaging 0.89
R4928:Rev3l UTSW 10 39823985 missense probably benign 0.30
R4970:Rev3l UTSW 10 39823330 missense probably benign 0.00
R4977:Rev3l UTSW 10 39823578 missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39823330 missense probably benign 0.00
R5261:Rev3l UTSW 10 39846729 missense probably damaging 1.00
R5419:Rev3l UTSW 10 39824931 missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39852075 critical splice donor site probably null
R5628:Rev3l UTSW 10 39822967 missense probably damaging 0.98
R5689:Rev3l UTSW 10 39794958 missense probably damaging 1.00
R5781:Rev3l UTSW 10 39823093 missense probably benign 0.00
R5829:Rev3l UTSW 10 39806906 missense probably damaging 0.97
R5984:Rev3l UTSW 10 39742689 intron probably benign
R5990:Rev3l UTSW 10 39823811 missense probably benign 0.17
R6054:Rev3l UTSW 10 39824150 missense probably benign 0.01
R6171:Rev3l UTSW 10 39862713 nonsense probably null
R6220:Rev3l UTSW 10 39822779 missense probably damaging 1.00
R6520:Rev3l UTSW 10 39822702 missense probably benign 0.06
R6798:Rev3l UTSW 10 39854763 missense probably damaging 1.00
R6811:Rev3l UTSW 10 39830921 nonsense probably null
R6812:Rev3l UTSW 10 39823548 missense probably benign
R6904:Rev3l UTSW 10 39821481 missense probably benign
R6905:Rev3l UTSW 10 39817327 missense probably benign 0.18
R6938:Rev3l UTSW 10 39862710 missense probably damaging 1.00
R7037:Rev3l UTSW 10 39851975 missense probably damaging 1.00
R7124:Rev3l UTSW 10 39822167 nonsense probably null
R7286:Rev3l UTSW 10 39823605 missense probably damaging 0.99
R7385:Rev3l UTSW 10 39823682 missense probably benign 0.01
R7575:Rev3l UTSW 10 39821445 missense possibly damaging 0.56
R7596:Rev3l UTSW 10 39821538 missense probably damaging 1.00
R7597:Rev3l UTSW 10 39822884 missense probably damaging 1.00
R7670:Rev3l UTSW 10 39836722 missense probably benign 0.01
R7804:Rev3l UTSW 10 39823485 missense probably benign 0.34
R7818:Rev3l UTSW 10 39823902 missense possibly damaging 0.54
R7874:Rev3l UTSW 10 39822495 missense possibly damaging 0.72
R7991:Rev3l UTSW 10 39863738 missense possibly damaging 0.52
R8059:Rev3l UTSW 10 39843495 missense probably damaging 1.00
R8174:Rev3l UTSW 10 39859115 missense probably damaging 1.00
R8187:Rev3l UTSW 10 39806697 missense probably benign
R8299:Rev3l UTSW 10 39821541 missense probably benign 0.01
R8352:Rev3l UTSW 10 39822903 missense probably damaging 1.00
R8452:Rev3l UTSW 10 39822903 missense probably damaging 1.00
R8468:Rev3l UTSW 10 39827991 missense probably damaging 0.99
R8487:Rev3l UTSW 10 39806848 missense probably damaging 1.00
R8512:Rev3l UTSW 10 39821538 missense probably damaging 1.00
R8554:Rev3l UTSW 10 39806842 missense probably benign 0.12
R8702:Rev3l UTSW 10 39838469 nonsense probably null
R8848:Rev3l UTSW 10 39846709 missense probably damaging 0.99
R8857:Rev3l UTSW 10 39794969 nonsense probably null
R8870:Rev3l UTSW 10 39862790 missense probably damaging 1.00
R9094:Rev3l UTSW 10 39824813 missense probably benign
R9175:Rev3l UTSW 10 39854768 missense possibly damaging 0.83
R9286:Rev3l UTSW 10 39806951 missense possibly damaging 0.54
R9299:Rev3l UTSW 10 39848003 missense probably damaging 1.00
R9307:Rev3l UTSW 10 39817153 missense probably benign 0.01
R9337:Rev3l UTSW 10 39822854 missense probably benign 0.40
R9342:Rev3l UTSW 10 39821462 missense probably benign
R9389:Rev3l UTSW 10 39822971 missense possibly damaging 0.47
R9395:Rev3l UTSW 10 39859223 critical splice donor site probably null
R9458:Rev3l UTSW 10 39783251 missense probably damaging 1.00
R9646:Rev3l UTSW 10 39822444 missense probably damaging 1.00
R9686:Rev3l UTSW 10 39867388 missense possibly damaging 0.67
X0022:Rev3l UTSW 10 39828607 critical splice donor site probably null
Z1088:Rev3l UTSW 10 39824318 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AAGTGTTTCTCAGTCTCCCACAG -3'
(R):5'- CTTTTCTGGCACATCCGAAG -3'

Sequencing Primer
(F):5'- GTCTCCCACAGGCAAACAGTTC -3'
(R):5'- CGAAGGATTACTGCAAAATGGTTCC -3'
Posted On 2022-07-18