Incidental Mutation 'R9481:Megf10'
ID 716276
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms LOC240312, 3000002B06Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R9481 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 57266162-57430539 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57395090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 484 (I484N)
Ref Sequence ENSEMBL: ENSMUSP00000075174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect probably benign
Transcript: ENSMUST00000075770
AA Change: I484N

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: I484N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139892
AA Change: I484N

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: I484N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Acsf2 C T 11: 94,464,044 (GRCm39) V47M probably benign Het
Ahcyl1 A T 3: 107,579,388 (GRCm39) C215* probably null Het
Ambn G T 5: 88,613,050 (GRCm39) probably null Het
Apol9b G T 15: 77,619,656 (GRCm39) V151L probably benign Het
Arid1b A G 17: 5,369,007 (GRCm39) Y1070C probably damaging Het
Arnt T C 3: 95,391,092 (GRCm39) L322P possibly damaging Het
Bdnf A G 2: 109,553,935 (GRCm39) D103G possibly damaging Het
Ccdc9 A T 7: 16,016,761 (GRCm39) D42E probably damaging Het
Cdh13 A G 8: 119,963,676 (GRCm39) T419A Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Clasp2 A T 9: 113,670,669 (GRCm39) R329W probably damaging Het
Csmd3 A G 15: 47,470,459 (GRCm39) C2495R Het
Cyba A T 8: 123,154,394 (GRCm39) I43N possibly damaging Het
Cyp2a5 A C 7: 26,540,511 (GRCm39) T375P possibly damaging Het
Cyp2r1 A G 7: 114,152,369 (GRCm39) F196S probably damaging Het
Efcab2 T C 1: 178,308,887 (GRCm39) F130S probably damaging Het
Eml6 T G 11: 29,788,641 (GRCm39) probably null Het
Fbln5 A T 12: 101,734,728 (GRCm39) C181* probably null Het
Glyatl3 A G 17: 41,221,016 (GRCm39) V117A probably benign Het
Gpc6 A G 14: 117,163,432 (GRCm39) S29G probably benign Het
Hadhb T G 5: 30,368,711 (GRCm39) S13A probably benign Het
Hook1 C T 4: 95,901,505 (GRCm39) R488C probably damaging Het
Icam5 A G 9: 20,948,877 (GRCm39) Y743C probably damaging Het
Il15ra T C 2: 11,724,854 (GRCm39) V108A probably benign Het
Itga1 T C 13: 115,152,753 (GRCm39) N223S probably benign Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,712,417 (GRCm39) probably benign Het
Kcnk1 T C 8: 126,756,281 (GRCm39) C268R probably damaging Het
Kctd19 A T 8: 106,120,249 (GRCm39) L264M probably benign Het
Kmt2c A T 5: 25,554,860 (GRCm39) I1258K probably benign Het
Kmt2c A T 5: 25,497,907 (GRCm39) D3949E probably damaging Het
Lyst G A 13: 13,857,653 (GRCm39) E2481K possibly damaging Het
Mettl21e T C 1: 44,245,857 (GRCm39) I130V probably benign Het
Nmnat2 C A 1: 152,962,181 (GRCm39) N140K possibly damaging Het
Nsmaf T C 4: 6,414,976 (GRCm39) K630R probably benign Het
Or2t1 C T 14: 14,328,756 (GRCm38) S215L probably benign Het
Or5w15 A T 2: 87,568,576 (GRCm39) F31I probably benign Het
Or8b38 G T 9: 37,972,707 (GRCm39) L30F probably benign Het
Or8g26 T C 9: 39,096,172 (GRCm39) S230P possibly damaging Het
Pafah1b2 G A 9: 45,884,284 (GRCm39) Q123* probably null Het
Ptprb T A 10: 116,155,353 (GRCm39) N415K probably benign Het
Rev3l T A 10: 39,701,033 (GRCm39) D1843E probably benign Het
Rps6ka4 T A 19: 6,809,372 (GRCm39) R427S possibly damaging Het
Scgb2b24 A T 7: 33,436,795 (GRCm39) L106I probably benign Het
Skint9 A T 4: 112,248,915 (GRCm39) M171K probably benign Het
Spata17 A G 1: 186,844,756 (GRCm39) V281A possibly damaging Het
Spef1 A T 2: 131,014,625 (GRCm39) V99E probably damaging Het
Srpra C T 9: 35,126,015 (GRCm39) T431I probably damaging Het
Stk32c G A 7: 138,768,173 (GRCm39) P36L unknown Het
Taar7d T C 10: 23,903,739 (GRCm39) I207T probably benign Het
Tle1 G A 4: 72,044,504 (GRCm39) T501I probably damaging Het
Tmem88b A T 4: 155,868,733 (GRCm39) W172R probably damaging Het
Usp48 G A 4: 137,340,996 (GRCm39) G332E probably benign Het
Vcl G T 14: 21,070,726 (GRCm39) V771L probably benign Het
Vmn1r200 T A 13: 22,579,911 (GRCm39) M238K probably damaging Het
Vmn2r96 A G 17: 18,793,621 (GRCm39) probably benign Het
Vsig10l G T 7: 43,112,795 (GRCm39) E18* probably null Het
Wdfy3 A G 5: 102,000,478 (GRCm39) L2964P probably benign Het
Zfp334 G A 2: 165,222,271 (GRCm39) R591W probably damaging Het
Zpld2 G A 4: 133,929,312 (GRCm39) P331L probably benign Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57,373,700 (GRCm39) missense probably damaging 1.00
IGL00736:Megf10 APN 18 57,425,782 (GRCm39) missense probably benign 0.35
IGL01631:Megf10 APN 18 57,392,869 (GRCm39) missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57,425,704 (GRCm39) missense probably damaging 1.00
IGL02747:Megf10 APN 18 57,423,565 (GRCm39) missense probably benign 0.43
IGL03298:Megf10 APN 18 57,416,910 (GRCm39) nonsense probably null
deep UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
megalodon UTSW 18 57,421,048 (GRCm39) nonsense probably null
sharkie UTSW 18 57,324,257 (GRCm39) nonsense probably null
IGL03046:Megf10 UTSW 18 57,421,055 (GRCm39) missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57,410,760 (GRCm39) missense probably damaging 1.00
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57,392,874 (GRCm39) missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57,386,054 (GRCm39) missense probably benign 0.34
R0602:Megf10 UTSW 18 57,395,172 (GRCm39) missense probably damaging 0.98
R0630:Megf10 UTSW 18 57,421,067 (GRCm39) missense probably benign 0.14
R0652:Megf10 UTSW 18 57,410,796 (GRCm39) missense probably benign 0.00
R0658:Megf10 UTSW 18 57,385,968 (GRCm39) missense probably benign 0.00
R0761:Megf10 UTSW 18 57,421,048 (GRCm39) nonsense probably null
R1013:Megf10 UTSW 18 57,394,291 (GRCm39) missense probably benign 0.00
R1130:Megf10 UTSW 18 57,395,078 (GRCm39) missense probably benign 0.06
R1451:Megf10 UTSW 18 57,385,931 (GRCm39) missense probably damaging 0.97
R1699:Megf10 UTSW 18 57,410,802 (GRCm39) splice site probably null
R1729:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1784:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1870:Megf10 UTSW 18 57,324,257 (GRCm39) nonsense probably null
R1961:Megf10 UTSW 18 57,345,426 (GRCm39) missense probably damaging 0.97
R2094:Megf10 UTSW 18 57,414,785 (GRCm39) nonsense probably null
R2213:Megf10 UTSW 18 57,421,081 (GRCm39) nonsense probably null
R2853:Megf10 UTSW 18 57,427,003 (GRCm39) missense probably damaging 1.00
R3772:Megf10 UTSW 18 57,416,934 (GRCm39) missense probably benign 0.39
R3774:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3775:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3776:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3858:Megf10 UTSW 18 57,408,907 (GRCm39) splice site probably benign
R3911:Megf10 UTSW 18 57,422,465 (GRCm39) missense probably damaging 0.99
R3966:Megf10 UTSW 18 57,313,646 (GRCm39) missense probably damaging 1.00
R4043:Megf10 UTSW 18 57,392,870 (GRCm39) missense probably damaging 0.98
R4131:Megf10 UTSW 18 57,313,607 (GRCm39) missense probably damaging 1.00
R4598:Megf10 UTSW 18 57,420,884 (GRCm39) missense probably damaging 1.00
R4598:Megf10 UTSW 18 57,322,675 (GRCm39) critical splice donor site probably null
R4726:Megf10 UTSW 18 57,420,864 (GRCm39) missense probably benign 0.32
R4765:Megf10 UTSW 18 57,420,866 (GRCm39) missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57,426,930 (GRCm39) missense probably benign 0.00
R4928:Megf10 UTSW 18 57,373,745 (GRCm39) missense probably benign
R5412:Megf10 UTSW 18 57,324,219 (GRCm39) missense probably damaging 0.99
R5901:Megf10 UTSW 18 57,410,180 (GRCm39) missense probably benign 0.11
R6015:Megf10 UTSW 18 57,386,100 (GRCm39) missense probably benign 0.01
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6041:Megf10 UTSW 18 57,313,621 (GRCm39) missense probably benign
R6369:Megf10 UTSW 18 57,394,259 (GRCm39) missense probably benign 0.06
R6479:Megf10 UTSW 18 57,379,642 (GRCm39) missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57,424,879 (GRCm39) missense probably benign 0.01
R7228:Megf10 UTSW 18 57,322,661 (GRCm39) missense probably damaging 1.00
R7296:Megf10 UTSW 18 57,408,825 (GRCm39) missense probably damaging 1.00
R7437:Megf10 UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
R7461:Megf10 UTSW 18 57,385,925 (GRCm39) missense probably damaging 0.98
R7488:Megf10 UTSW 18 57,324,187 (GRCm39) missense probably damaging 0.99
R7492:Megf10 UTSW 18 57,424,866 (GRCm39) missense probably benign 0.00
R7542:Megf10 UTSW 18 57,322,642 (GRCm39) missense probably benign 0.07
R7636:Megf10 UTSW 18 57,410,061 (GRCm39) missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7650:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7713:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7714:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7716:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7796:Megf10 UTSW 18 57,410,731 (GRCm39) missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57,373,807 (GRCm39) missense probably benign 0.05
R8221:Megf10 UTSW 18 57,416,893 (GRCm39) missense probably benign 0.00
R8527:Megf10 UTSW 18 57,425,790 (GRCm39) missense probably benign 0.00
R8559:Megf10 UTSW 18 57,373,699 (GRCm39) missense probably damaging 1.00
R9117:Megf10 UTSW 18 57,392,773 (GRCm39) missense probably damaging 1.00
R9337:Megf10 UTSW 18 57,394,252 (GRCm39) nonsense probably null
R9644:Megf10 UTSW 18 57,375,773 (GRCm39) missense probably benign
RF003:Megf10 UTSW 18 57,427,099 (GRCm39) unclassified probably benign
Z1176:Megf10 UTSW 18 57,410,766 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTTCTGGTCGGTCAAGGC -3'
(R):5'- AAAGAAGTCATCCCTCCGGC -3'

Sequencing Primer
(F):5'- CTGGTCGGTCAAGGCCTTTTG -3'
(R):5'- GGCATAGTCTTCCAGGCATG -3'
Posted On 2022-07-18