Incidental Mutation 'R9482:Or4a72'
ID 716288
Institutional Source Beutler Lab
Gene Symbol Or4a72
Ensembl Gene ENSMUSG00000111456
Gene Name olfactory receptor family 4 subfamily A member 72
Synonyms GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R9482 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 89405056-89406117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89405953 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 39 (G39D)
Ref Sequence ENSEMBL: ENSMUSP00000150791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
AlphaFold A0A1L1SQJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000214870
AA Change: G39D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217402
AA Change: G39D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,307,423 (GRCm39) V793A probably benign Het
Als2 G T 1: 59,231,109 (GRCm39) P834Q probably damaging Het
Alx1 T C 10: 102,864,335 (GRCm39) T45A probably benign Het
Angptl7 T G 4: 148,584,575 (GRCm39) S58R possibly damaging Het
Atg3 A G 16: 44,979,481 (GRCm39) T7A probably benign Het
Bpifc A T 10: 85,815,118 (GRCm39) S283T possibly damaging Het
C2cd2l T A 9: 44,227,914 (GRCm39) E231V probably damaging Het
Cdk5r2 T C 1: 74,894,504 (GRCm39) V83A probably damaging Het
Chst10 T C 1: 38,907,116 (GRCm39) E178G probably damaging Het
Crocc2 T A 1: 93,143,106 (GRCm39) L1236Q probably benign Het
Dleu7 T C 14: 62,514,351 (GRCm39) *210W probably null Het
Emc1 T G 4: 139,088,201 (GRCm39) V323G probably damaging Het
Fcrla T C 1: 170,745,949 (GRCm39) T278A probably benign Het
Flrt3 T C 2: 140,503,590 (GRCm39) T13A probably benign Het
Galntl6 A T 8: 58,310,549 (GRCm39) probably null Het
Gen1 A G 12: 11,305,186 (GRCm39) V203A possibly damaging Het
Gm3149 T A 14: 15,698,287 (GRCm39) V169E probably benign Het
Hjurp CTCCTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCA C 1: 88,193,996 (GRCm39) probably benign Het
Hmcn1 A G 1: 150,610,281 (GRCm39) S1463P probably benign Het
Irag1 A T 7: 110,545,259 (GRCm39) D12E probably benign Het
Jsrp1 A T 10: 80,644,734 (GRCm39) I224N possibly damaging Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Kcnma1 A T 14: 23,441,033 (GRCm39) M591K probably benign Het
Kmt2d A C 15: 98,763,046 (GRCm39) W268G probably damaging Het
Knop1 A G 7: 118,447,710 (GRCm39) S417P unknown Het
Lpin3 T C 2: 160,746,416 (GRCm39) F692L probably damaging Het
Mycbp T C 4: 123,803,880 (GRCm39) C130R unknown Het
Myh1 T C 11: 67,108,745 (GRCm39) I1387T probably damaging Het
Nbeal2 T C 9: 110,463,066 (GRCm39) D1333G probably benign Het
Nedd4l G T 18: 65,021,031 (GRCm39) probably benign Het
Nucks1 A G 1: 131,846,744 (GRCm39) N7D probably benign Het
Nup210 A G 6: 91,019,608 (GRCm39) I991T probably damaging Het
Pcdhb3 A G 18: 37,434,736 (GRCm39) D234G probably damaging Het
Phyh C T 2: 4,923,863 (GRCm39) probably benign Het
Pik3c2a G A 7: 115,961,289 (GRCm39) T1070I probably benign Het
Prss52 C T 14: 64,351,129 (GRCm39) L305F probably damaging Het
Rasef T C 4: 73,708,933 (GRCm39) D100G probably benign Het
Rb1 A C 14: 73,443,493 (GRCm39) M754R probably damaging Het
Rbm6 T C 9: 107,669,208 (GRCm39) Q568R possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Serf2 T C 2: 121,281,206 (GRCm39) S41P possibly damaging Het
Serf2 C A 2: 121,281,205 (GRCm39) D40E possibly damaging Het
Sh2b1 AGCTC AGCTCAGCCACGGGGACCCGCTC 7: 126,066,768 (GRCm39) probably benign Het
Sympk G T 7: 18,771,986 (GRCm39) R350L possibly damaging Het
Tab2 C A 10: 7,795,124 (GRCm39) V379L probably damaging Het
Tnk1 T G 11: 69,743,666 (GRCm39) T485P probably benign Het
Trmt6 T C 2: 132,648,699 (GRCm39) T412A probably benign Het
Vgll3 A G 16: 65,636,229 (GRCm39) T182A probably benign Het
Zfat A G 15: 68,084,652 (GRCm39) S80P probably damaging Het
Zfp1004 C A 2: 150,034,711 (GRCm39) T344K probably benign Het
Zfyve26 A G 12: 79,291,239 (GRCm39) L2122S probably damaging Het
Other mutations in Or4a72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Or4a72 APN 2 89,405,767 (GRCm39) missense possibly damaging 0.68
IGL01690:Or4a72 APN 2 89,405,557 (GRCm39) missense probably benign 0.09
IGL02334:Or4a72 APN 2 89,405,668 (GRCm39) missense possibly damaging 0.95
IGL02435:Or4a72 APN 2 89,405,890 (GRCm39) missense probably damaging 0.99
IGL02793:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL02875:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL03218:Or4a72 APN 2 89,405,935 (GRCm39) missense probably benign 0.09
IGL03392:Or4a72 APN 2 89,405,593 (GRCm39) missense probably damaging 0.96
H8786:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
I0000:Or4a72 UTSW 2 89,405,497 (GRCm39) missense probably damaging 1.00
R0044:Or4a72 UTSW 2 89,405,974 (GRCm39) missense possibly damaging 0.68
R0190:Or4a72 UTSW 2 89,405,302 (GRCm39) missense probably damaging 0.98
R1585:Or4a72 UTSW 2 89,405,746 (GRCm39) missense possibly damaging 0.89
R1902:Or4a72 UTSW 2 89,405,947 (GRCm39) missense possibly damaging 0.77
R2018:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2019:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2020:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2021:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2030:Or4a72 UTSW 2 89,405,558 (GRCm39) missense probably benign 0.00
R2133:Or4a72 UTSW 2 89,405,600 (GRCm39) nonsense probably null
R3850:Or4a72 UTSW 2 89,405,378 (GRCm39) missense probably damaging 0.99
R4066:Or4a72 UTSW 2 89,405,523 (GRCm39) missense probably damaging 1.00
R4754:Or4a72 UTSW 2 89,405,391 (GRCm39) missense probably benign
R4923:Or4a72 UTSW 2 89,406,023 (GRCm39) missense probably damaging 0.98
R5303:Or4a72 UTSW 2 89,405,345 (GRCm39) missense possibly damaging 0.88
R5574:Or4a72 UTSW 2 89,405,321 (GRCm39) missense possibly damaging 0.94
R6083:Or4a72 UTSW 2 89,406,016 (GRCm39) missense probably benign 0.42
R6188:Or4a72 UTSW 2 89,405,538 (GRCm39) nonsense probably null
R6724:Or4a72 UTSW 2 89,405,309 (GRCm39) missense probably benign 0.26
R6964:Or4a72 UTSW 2 89,405,333 (GRCm39) missense probably benign
R7066:Or4a72 UTSW 2 89,406,047 (GRCm39) missense probably damaging 0.98
R7401:Or4a72 UTSW 2 89,405,449 (GRCm39) missense probably benign 0.27
R8232:Or4a72 UTSW 2 89,405,938 (GRCm39) missense noncoding transcript
R8558:Or4a72 UTSW 2 89,405,329 (GRCm39) missense probably damaging 1.00
R8708:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGATCATAAGCCATTGCCAC -3'
(R):5'- CCAGATTCTGTTCTTAGGAGCTG -3'

Sequencing Primer
(F):5'- CTCTATAAAGAGCTGGCTCATGC -3'
(R):5'- GGAGCTGCCATCTCTAATATAATCC -3'
Posted On 2022-07-18