Incidental Mutation 'R9482:Lpin3'
ID 716294
Institutional Source Beutler Lab
Gene Symbol Lpin3
Ensembl Gene ENSMUSG00000027412
Gene Name lipin 3
Synonyms 9130206L11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9482 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 160880670-160906002 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 160904496 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 692 (F692L)
Ref Sequence ENSEMBL: ENSMUSP00000105083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
AlphaFold Q99PI4
Predicted Effect probably damaging
Transcript: ENSMUST00000040872
AA Change: F682L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412
AA Change: F682L

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057169
SMART Domains Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 55 125 7.3e-18 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 281 295 N/A INTRINSIC
low complexity region 359 381 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109454
SMART Domains Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 54 127 6.4e-22 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 312 334 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109455
AA Change: F651L

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412
AA Change: F651L

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109456
AA Change: F682L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412
AA Change: F682L

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109457
AA Change: F692L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412
AA Change: F692L

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,431,679 V793A probably benign Het
Als2 G T 1: 59,191,950 P834Q probably damaging Het
Alx1 T C 10: 103,028,474 T45A probably benign Het
Angptl7 T G 4: 148,500,118 S58R possibly damaging Het
Atg3 A G 16: 45,159,118 T7A probably benign Het
Bpifc A T 10: 85,979,254 S283T possibly damaging Het
C2cd2l T A 9: 44,316,617 E231V probably damaging Het
Cdk5r2 T C 1: 74,855,345 V83A probably damaging Het
Chst10 T C 1: 38,868,035 E178G probably damaging Het
Crocc2 T A 1: 93,215,384 L1236Q probably benign Het
Dleu7 T C 14: 62,276,902 *210W probably null Het
Emc1 T G 4: 139,360,890 V323G probably damaging Het
Fcrla T C 1: 170,918,380 T278A probably benign Het
Flrt3 T C 2: 140,661,670 T13A probably benign Het
Galntl6 A T 8: 57,857,515 probably null Het
Gen1 A G 12: 11,255,185 V203A possibly damaging Het
Gm14139 C A 2: 150,192,791 T344K probably benign Het
Gm3149 T A 14: 4,320,208 V169E probably benign Het
Hjurp CTCCTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCA C 1: 88,266,274 probably benign Het
Hmcn1 A G 1: 150,734,530 S1463P probably benign Het
Jsrp1 A T 10: 80,808,900 I224N possibly damaging Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Kcnma1 A T 14: 23,390,965 M591K probably benign Het
Kmt2d A C 15: 98,865,165 W268G probably damaging Het
Knop1 A G 7: 118,848,487 S417P unknown Het
Mrvi1 A T 7: 110,946,052 D12E probably benign Het
Mycbp T C 4: 123,910,087 C130R unknown Het
Myh1 T C 11: 67,217,919 I1387T probably damaging Het
Nbeal2 T C 9: 110,633,998 D1333G probably benign Het
Nedd4l G T 18: 64,887,960 probably benign Het
Nucks1 A G 1: 131,919,006 N7D probably benign Het
Nup210 A G 6: 91,042,626 I991T probably damaging Het
Olfr1245 C T 2: 89,575,609 G39D probably damaging Het
Pcdhb3 A G 18: 37,301,683 D234G probably damaging Het
Phyh C T 2: 4,919,052 probably benign Het
Pik3c2a G A 7: 116,362,054 T1070I probably benign Het
Prss52 C T 14: 64,113,680 L305F probably damaging Het
Rasef T C 4: 73,790,696 D100G probably benign Het
Rb1 A C 14: 73,206,053 M754R probably damaging Het
Rbm6 T C 9: 107,792,009 Q568R possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Serf2 C A 2: 121,450,724 D40E possibly damaging Het
Serf2 T C 2: 121,450,725 S41P possibly damaging Het
Sh2b1 AGCTC AGCTCAGCCACGGGGACCCGCTC 7: 126,467,596 probably benign Het
Sympk G T 7: 19,038,061 R350L possibly damaging Het
Tab2 C A 10: 7,919,360 V379L probably damaging Het
Tnk1 T G 11: 69,852,840 T485P probably benign Het
Trmt6 T C 2: 132,806,779 T412A probably benign Het
Vgll3 A G 16: 65,839,343 T182A probably benign Het
Zfat A G 15: 68,212,803 S80P probably damaging Het
Zfyve26 A G 12: 79,244,465 L2122S probably damaging Het
Other mutations in Lpin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Lpin3 APN 2 160893998 missense probably damaging 1.00
IGL01373:Lpin3 APN 2 160903729 missense probably damaging 1.00
IGL01576:Lpin3 APN 2 160897127 missense probably benign 0.02
IGL02124:Lpin3 APN 2 160895833 critical splice donor site probably null
IGL02272:Lpin3 APN 2 160901661 missense probably benign 0.15
IGL02314:Lpin3 APN 2 160898718 nonsense probably null
IGL02374:Lpin3 APN 2 160895838 splice site probably benign
IGL02554:Lpin3 APN 2 160896787 missense probably damaging 1.00
IGL02693:Lpin3 APN 2 160905055 missense probably damaging 1.00
IGL02858:Lpin3 APN 2 160898620 splice site probably benign
IGL03143:Lpin3 APN 2 160903598 splice site probably benign
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0329:Lpin3 UTSW 2 160905305 missense probably benign
R0330:Lpin3 UTSW 2 160905305 missense probably benign
R0570:Lpin3 UTSW 2 160904024 splice site probably benign
R0633:Lpin3 UTSW 2 160903974 missense probably damaging 0.99
R0781:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1109:Lpin3 UTSW 2 160899021 missense probably damaging 1.00
R1110:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1513:Lpin3 UTSW 2 160904548 missense probably damaging 1.00
R1543:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
R1785:Lpin3 UTSW 2 160896809 nonsense probably null
R1786:Lpin3 UTSW 2 160896809 nonsense probably null
R1896:Lpin3 UTSW 2 160905298 missense probably damaging 1.00
R4440:Lpin3 UTSW 2 160898645 missense probably benign
R4470:Lpin3 UTSW 2 160895434 missense probably benign 0.00
R4996:Lpin3 UTSW 2 160905287 missense probably damaging 1.00
R5014:Lpin3 UTSW 2 160904828 missense probably damaging 1.00
R5124:Lpin3 UTSW 2 160897061 missense probably benign
R5184:Lpin3 UTSW 2 160897138 missense probably benign
R5405:Lpin3 UTSW 2 160903929 missense probably damaging 1.00
R5442:Lpin3 UTSW 2 160905016 missense probably damaging 1.00
R5666:Lpin3 UTSW 2 160897330 missense probably benign
R5670:Lpin3 UTSW 2 160897330 missense probably benign
R5693:Lpin3 UTSW 2 160895400 missense probably benign 0.00
R6084:Lpin3 UTSW 2 160895801 missense probably benign 0.38
R6994:Lpin3 UTSW 2 160904883 missense probably damaging 1.00
R7090:Lpin3 UTSW 2 160896752 missense probably damaging 0.96
R7157:Lpin3 UTSW 2 160898707 missense probably benign 0.02
R7207:Lpin3 UTSW 2 160894003 nonsense probably null
R7430:Lpin3 UTSW 2 160898666 missense probably benign 0.06
R7459:Lpin3 UTSW 2 160897300 missense probably benign 0.06
R7603:Lpin3 UTSW 2 160903754 splice site probably null
R7644:Lpin3 UTSW 2 160896770 missense probably benign 0.02
R7706:Lpin3 UTSW 2 160905290 missense probably damaging 1.00
R7803:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
R8443:Lpin3 UTSW 2 160895353 missense probably damaging 1.00
R8985:Lpin3 UTSW 2 160896754 missense probably benign 0.00
R9288:Lpin3 UTSW 2 160903632 missense probably damaging 1.00
R9385:Lpin3 UTSW 2 160897073 missense probably benign
R9455:Lpin3 UTSW 2 160895339 missense probably benign 0.02
R9700:Lpin3 UTSW 2 160898645 missense probably benign 0.11
R9732:Lpin3 UTSW 2 160892276 missense probably damaging 1.00
X0002:Lpin3 UTSW 2 160903717 missense probably damaging 1.00
Z1088:Lpin3 UTSW 2 160892231 missense probably damaging 0.99
Z1176:Lpin3 UTSW 2 160899785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGTGTCCAAGTTCCAACTG -3'
(R):5'- GGCAAATGTGTGCTAGGCTG -3'

Sequencing Primer
(F):5'- TGGGACAGATGCTGAGAATACCC -3'
(R):5'- CTGGAGGTGCTCTTGCC -3'
Posted On 2022-07-18