Incidental Mutation 'R9482:Emc1'
ID 716297
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock # R9482 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 139352587-139378730 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 139360890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 323 (V323G)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect possibly damaging
Transcript: ENSMUST00000042096
AA Change: V323G

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: V323G

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082262
AA Change: V323G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: V323G

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155700
AA Change: V150G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000179784
AA Change: V323G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: V323G

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,431,679 V793A probably benign Het
Als2 G T 1: 59,191,950 P834Q probably damaging Het
Alx1 T C 10: 103,028,474 T45A probably benign Het
Angptl7 T G 4: 148,500,118 S58R possibly damaging Het
Atg3 A G 16: 45,159,118 T7A probably benign Het
Bpifc A T 10: 85,979,254 S283T possibly damaging Het
C2cd2l T A 9: 44,316,617 E231V probably damaging Het
Cdk5r2 T C 1: 74,855,345 V83A probably damaging Het
Chst10 T C 1: 38,868,035 E178G probably damaging Het
Crocc2 T A 1: 93,215,384 L1236Q probably benign Het
Dleu7 T C 14: 62,276,902 *210W probably null Het
Fcrla T C 1: 170,918,380 T278A probably benign Het
Flrt3 T C 2: 140,661,670 T13A probably benign Het
Galntl6 A T 8: 57,857,515 probably null Het
Gen1 A G 12: 11,255,185 V203A possibly damaging Het
Gm14139 C A 2: 150,192,791 T344K probably benign Het
Gm3149 T A 14: 4,320,208 V169E probably benign Het
Hjurp CTCCTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCA C 1: 88,266,274 probably benign Het
Hmcn1 A G 1: 150,734,530 S1463P probably benign Het
Jsrp1 A T 10: 80,808,900 I224N possibly damaging Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Kcnma1 A T 14: 23,390,965 M591K probably benign Het
Kmt2d A C 15: 98,865,165 W268G probably damaging Het
Knop1 A G 7: 118,848,487 S417P unknown Het
Lpin3 T C 2: 160,904,496 F692L probably damaging Het
Mrvi1 A T 7: 110,946,052 D12E probably benign Het
Mycbp T C 4: 123,910,087 C130R unknown Het
Myh1 T C 11: 67,217,919 I1387T probably damaging Het
Nbeal2 T C 9: 110,633,998 D1333G probably benign Het
Nedd4l G T 18: 64,887,960 probably benign Het
Nucks1 A G 1: 131,919,006 N7D probably benign Het
Nup210 A G 6: 91,042,626 I991T probably damaging Het
Olfr1245 C T 2: 89,575,609 G39D probably damaging Het
Pcdhb3 A G 18: 37,301,683 D234G probably damaging Het
Phyh C T 2: 4,919,052 probably benign Het
Pik3c2a G A 7: 116,362,054 T1070I probably benign Het
Prss52 C T 14: 64,113,680 L305F probably damaging Het
Rasef T C 4: 73,790,696 D100G probably benign Het
Rb1 A C 14: 73,206,053 M754R probably damaging Het
Rbm6 T C 9: 107,792,009 Q568R possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Serf2 C A 2: 121,450,724 D40E possibly damaging Het
Serf2 T C 2: 121,450,725 S41P possibly damaging Het
Sh2b1 AGCTC AGCTCAGCCACGGGGACCCGCTC 7: 126,467,596 probably benign Het
Sympk G T 7: 19,038,061 R350L possibly damaging Het
Tab2 C A 10: 7,919,360 V379L probably damaging Het
Tnk1 T G 11: 69,852,840 T485P probably benign Het
Trmt6 T C 2: 132,806,779 T412A probably benign Het
Vgll3 A G 16: 65,839,343 T182A probably benign Het
Zfat A G 15: 68,212,803 S80P probably damaging Het
Zfyve26 A G 12: 79,244,465 L2122S probably damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139366394 missense probably damaging 0.98
R9610:Emc1 UTSW 4 139363724 missense probably benign 0.38
R9611:Emc1 UTSW 4 139363724 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GCCGTGACTCTGCTTAAGAAC -3'
(R):5'- TGGAGTCTCTGTAGAAAGCTGTAG -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- TCTCTGTAGAAAGCTGTAGAGATG -3'
Posted On 2022-07-18