Incidental Mutation 'R9482:Nedd4l'
ID 716329
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R9482 (G1)
Quality Score 114.051
Status Not validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 65021031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000224385] [ENSMUST00000225057] [ENSMUST00000225261]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000163516
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224347
Predicted Effect probably benign
Transcript: ENSMUST00000224385
Predicted Effect probably benign
Transcript: ENSMUST00000225057
Predicted Effect probably benign
Transcript: ENSMUST00000225261
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,307,423 (GRCm39) V793A probably benign Het
Als2 G T 1: 59,231,109 (GRCm39) P834Q probably damaging Het
Alx1 T C 10: 102,864,335 (GRCm39) T45A probably benign Het
Angptl7 T G 4: 148,584,575 (GRCm39) S58R possibly damaging Het
Atg3 A G 16: 44,979,481 (GRCm39) T7A probably benign Het
Bpifc A T 10: 85,815,118 (GRCm39) S283T possibly damaging Het
C2cd2l T A 9: 44,227,914 (GRCm39) E231V probably damaging Het
Cdk5r2 T C 1: 74,894,504 (GRCm39) V83A probably damaging Het
Chst10 T C 1: 38,907,116 (GRCm39) E178G probably damaging Het
Crocc2 T A 1: 93,143,106 (GRCm39) L1236Q probably benign Het
Dleu7 T C 14: 62,514,351 (GRCm39) *210W probably null Het
Emc1 T G 4: 139,088,201 (GRCm39) V323G probably damaging Het
Fcrla T C 1: 170,745,949 (GRCm39) T278A probably benign Het
Flrt3 T C 2: 140,503,590 (GRCm39) T13A probably benign Het
Galntl6 A T 8: 58,310,549 (GRCm39) probably null Het
Gen1 A G 12: 11,305,186 (GRCm39) V203A possibly damaging Het
Gm3149 T A 14: 15,698,287 (GRCm39) V169E probably benign Het
Hjurp CTCCTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCA C 1: 88,193,996 (GRCm39) probably benign Het
Hmcn1 A G 1: 150,610,281 (GRCm39) S1463P probably benign Het
Irag1 A T 7: 110,545,259 (GRCm39) D12E probably benign Het
Jsrp1 A T 10: 80,644,734 (GRCm39) I224N possibly damaging Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Kcnma1 A T 14: 23,441,033 (GRCm39) M591K probably benign Het
Kmt2d A C 15: 98,763,046 (GRCm39) W268G probably damaging Het
Knop1 A G 7: 118,447,710 (GRCm39) S417P unknown Het
Lpin3 T C 2: 160,746,416 (GRCm39) F692L probably damaging Het
Mycbp T C 4: 123,803,880 (GRCm39) C130R unknown Het
Myh1 T C 11: 67,108,745 (GRCm39) I1387T probably damaging Het
Nbeal2 T C 9: 110,463,066 (GRCm39) D1333G probably benign Het
Nucks1 A G 1: 131,846,744 (GRCm39) N7D probably benign Het
Nup210 A G 6: 91,019,608 (GRCm39) I991T probably damaging Het
Or4a72 C T 2: 89,405,953 (GRCm39) G39D probably damaging Het
Pcdhb3 A G 18: 37,434,736 (GRCm39) D234G probably damaging Het
Phyh C T 2: 4,923,863 (GRCm39) probably benign Het
Pik3c2a G A 7: 115,961,289 (GRCm39) T1070I probably benign Het
Prss52 C T 14: 64,351,129 (GRCm39) L305F probably damaging Het
Rasef T C 4: 73,708,933 (GRCm39) D100G probably benign Het
Rb1 A C 14: 73,443,493 (GRCm39) M754R probably damaging Het
Rbm6 T C 9: 107,669,208 (GRCm39) Q568R possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Serf2 T C 2: 121,281,206 (GRCm39) S41P possibly damaging Het
Serf2 C A 2: 121,281,205 (GRCm39) D40E possibly damaging Het
Sh2b1 AGCTC AGCTCAGCCACGGGGACCCGCTC 7: 126,066,768 (GRCm39) probably benign Het
Sympk G T 7: 18,771,986 (GRCm39) R350L possibly damaging Het
Tab2 C A 10: 7,795,124 (GRCm39) V379L probably damaging Het
Tnk1 T G 11: 69,743,666 (GRCm39) T485P probably benign Het
Trmt6 T C 2: 132,648,699 (GRCm39) T412A probably benign Het
Vgll3 A G 16: 65,636,229 (GRCm39) T182A probably benign Het
Zfat A G 15: 68,084,652 (GRCm39) S80P probably damaging Het
Zfp1004 C A 2: 150,034,711 (GRCm39) T344K probably benign Het
Zfyve26 A G 12: 79,291,239 (GRCm39) L2122S probably damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCCAGTTCACCGGGTC -3'
(R):5'- GGTCACCCGGAATCTTGGAG -3'

Sequencing Primer
(F):5'- TGGGGCGAAACACCACC -3'
(R):5'- ACGCTCACAGTGGAGTGG -3'
Posted On 2022-07-18