Incidental Mutation 'R9483:Slc6a17'
ID 716347
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms NTT4, D130012J15Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R9483 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 107374864-107425334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107378772 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 637 (I637F)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
AlphaFold Q8BJI1
Predicted Effect possibly damaging
Transcript: ENSMUST00000029499
AA Change: I634F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: I634F

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168211
AA Change: I596F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: I596F

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169449
AA Change: I637F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: I637F

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,339,010 (GRCm39) M334K probably benign Het
Abca1 A T 4: 53,060,351 (GRCm39) I1525N probably benign Het
Abca4 A T 3: 121,879,275 (GRCm39) I398F Het
Acbd3 A G 1: 180,572,721 (GRCm39) D327G probably benign Het
Acsm3 A G 7: 119,383,166 (GRCm39) T544A probably damaging Het
Atp11a C T 8: 12,901,087 (GRCm39) T972M probably damaging Het
Cbfb C T 8: 105,929,123 (GRCm39) R147* probably null Het
Ccdc17 G T 4: 116,454,144 (GRCm39) R54L probably benign Het
Cracdl T G 1: 37,670,496 (GRCm39) E148A probably damaging Het
Cuedc2 G T 19: 46,319,399 (GRCm39) A223E probably benign Het
Cul5 T C 9: 53,532,474 (GRCm39) I787V probably benign Het
D430041D05Rik T A 2: 104,087,563 (GRCm39) H471L probably benign Het
Ddx39a T C 8: 84,448,916 (GRCm39) Y264H probably benign Het
Dlgap3 C A 4: 127,127,665 (GRCm39) R778S probably damaging Het
Esrrg T C 1: 187,930,848 (GRCm39) V313A probably damaging Het
Fam124a T C 14: 62,844,100 (GRCm39) I536T probably damaging Het
Fbxo21 T C 5: 118,127,272 (GRCm39) F275L possibly damaging Het
Gabrg1 C A 5: 70,999,558 (GRCm39) G2V possibly damaging Het
Gcc1 G T 6: 28,418,089 (GRCm39) A748D probably damaging Het
Gjb6 T C 14: 57,361,511 (GRCm39) D250G probably benign Het
Gm44501 A T 17: 40,889,872 (GRCm39) K129* probably null Het
Hmcn2 T G 2: 31,320,375 (GRCm39) L3952R Het
Hpd A G 5: 123,312,535 (GRCm39) I278T probably damaging Het
Igsf3 T A 3: 101,346,904 (GRCm39) F613Y probably damaging Het
Igsf3 T C 3: 101,346,817 (GRCm39) F584S probably damaging Het
Ik A G 18: 36,886,635 (GRCm39) D369G probably benign Het
Ikbke A G 1: 131,198,719 (GRCm39) L365P probably damaging Het
Il22ra2 A T 10: 19,508,542 (GRCm39) Q190L possibly damaging Het
Itga6 T C 2: 71,679,834 (GRCm39) V1033A probably benign Het
Kif18a T C 2: 109,120,032 (GRCm39) Y112H probably damaging Het
Krt75 T C 15: 101,482,238 (GRCm39) H10R probably benign Het
L3mbtl1 T A 2: 162,790,734 (GRCm39) L93H probably benign Het
Lrfn1 G A 7: 28,158,183 (GRCm39) C34Y probably damaging Het
Lrrc47 A T 4: 154,101,920 (GRCm39) I396F probably damaging Het
Mgat3 T A 15: 80,095,641 (GRCm39) V156E probably benign Het
Mtus2 A G 5: 148,232,300 (GRCm39) D1120G possibly damaging Het
Muc5ac G T 7: 141,365,465 (GRCm39) E2700* probably null Het
Nxpe5 A T 5: 138,228,591 (GRCm39) probably benign Het
Or51v15-ps1 T C 7: 103,278,931 (GRCm39) T79A probably damaging Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Pcdhga4 T A 18: 37,819,746 (GRCm39) S432T possibly damaging Het
Pdk4 T A 6: 5,486,716 (GRCm39) M353L probably benign Het
Ppp1r13b T A 12: 111,800,210 (GRCm39) K645N probably benign Het
Ppt1 A T 4: 122,751,367 (GRCm39) D288V possibly damaging Het
Prkcb A G 7: 122,181,663 (GRCm39) Y417C probably damaging Het
Prss22 A G 17: 24,215,721 (GRCm39) I67T probably damaging Het
Rab29 T C 1: 131,795,508 (GRCm39) V40A possibly damaging Het
Rae1 T C 2: 172,849,941 (GRCm39) probably null Het
Rasa3 C T 8: 13,630,033 (GRCm39) probably null Het
Rasgrp3 A G 17: 75,807,717 (GRCm39) D258G probably benign Het
Rcc1 T A 4: 132,062,808 (GRCm39) T208S probably benign Het
Rgs3 C A 4: 62,575,354 (GRCm39) Y580* probably null Het
Rpe65 C T 3: 159,328,318 (GRCm39) P405S probably damaging Het
Rsf1 GGCGGC GGCGGCGGCAGCGGC 7: 97,229,137 (GRCm39) probably benign Het
Rsph4a A G 10: 33,790,418 (GRCm39) E669G probably damaging Het
Rusc1 A T 3: 88,994,113 (GRCm39) V964E probably benign Het
Rusc2 A G 4: 43,415,897 (GRCm39) N401S probably damaging Het
Slc10a1 G T 12: 81,002,864 (GRCm39) T258K probably damaging Het
Slc5a9 A G 4: 111,747,418 (GRCm39) L323P probably damaging Het
Slc8a2 A G 7: 15,886,780 (GRCm39) E641G possibly damaging Het
Sptbn2 G T 19: 4,789,974 (GRCm39) A1321S probably damaging Het
Ssh2 G T 11: 77,283,976 (GRCm39) A77S possibly damaging Het
St13 G T 15: 81,250,587 (GRCm39) N316K probably damaging Het
Taf10 A G 7: 105,393,062 (GRCm39) M121T probably benign Het
Tcta T C 9: 108,182,942 (GRCm39) T68A probably damaging Het
Timd2 A T 11: 46,577,889 (GRCm39) Y81N probably damaging Het
Tln2 T C 9: 67,299,769 (GRCm39) E161G probably damaging Het
Tmed10 T C 12: 85,397,621 (GRCm39) I123V probably benign Het
Ttf1 T C 2: 28,969,492 (GRCm39) probably null Het
Tubg1 A G 11: 101,016,886 (GRCm39) D396G probably damaging Het
Uhmk1 A G 1: 170,034,913 (GRCm39) probably null Het
Unc13a C T 8: 72,103,221 (GRCm39) A922T probably benign Het
Usp24 T A 4: 106,219,379 (GRCm39) V525E probably damaging Het
Usp28 C A 9: 48,947,037 (GRCm39) Q823K probably damaging Het
Vldlr A T 19: 27,224,031 (GRCm39) I764F probably benign Het
Vmn2r88 T C 14: 51,648,641 (GRCm39) Y62H Het
Zfp423 T A 8: 88,507,725 (GRCm39) N873I possibly damaging Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107,400,493 (GRCm39) missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107,402,993 (GRCm39) missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107,384,622 (GRCm39) missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107,384,183 (GRCm39) missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107,400,388 (GRCm39) missense possibly damaging 0.90
R1551:Slc6a17 UTSW 3 107,379,443 (GRCm39) missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107,381,702 (GRCm39) missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107,380,895 (GRCm39) missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107,398,817 (GRCm39) nonsense probably null
R3708:Slc6a17 UTSW 3 107,400,401 (GRCm39) missense probably benign
R3814:Slc6a17 UTSW 3 107,378,633 (GRCm39) missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107,381,597 (GRCm39) missense probably benign
R4807:Slc6a17 UTSW 3 107,407,803 (GRCm39) missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107,378,753 (GRCm39) nonsense probably null
R6076:Slc6a17 UTSW 3 107,379,387 (GRCm39) missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107,407,722 (GRCm39) missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107,378,703 (GRCm39) missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107,378,755 (GRCm39) missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107,400,464 (GRCm39) missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107,398,794 (GRCm39) missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107,378,668 (GRCm39) missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107,381,671 (GRCm39) missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107,384,214 (GRCm39) missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R8041:Slc6a17 UTSW 3 107,381,744 (GRCm39) missense probably damaging 1.00
R8305:Slc6a17 UTSW 3 107,380,901 (GRCm39) missense probably benign 0.31
R8306:Slc6a17 UTSW 3 107,380,985 (GRCm39) missense probably benign
R8488:Slc6a17 UTSW 3 107,384,574 (GRCm39) missense possibly damaging 0.84
R8930:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R8932:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R9287:Slc6a17 UTSW 3 107,384,551 (GRCm39) missense probably damaging 1.00
R9601:Slc6a17 UTSW 3 107,380,930 (GRCm39) missense possibly damaging 0.95
R9617:Slc6a17 UTSW 3 107,384,685 (GRCm39) missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107,400,422 (GRCm39) missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107,407,684 (GRCm39) missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107,384,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCAAGGGTGATGTGCTGC -3'
(R):5'- ATCAGTACTGCTACTTGGTGG -3'

Sequencing Primer
(F):5'- GTGATGTGCTGCCAGGC -3'
(R):5'- AGTACTGCTACTTGGTGGTGGTG -3'
Posted On 2022-07-18