Mutagenetix > Incidental Mutation

Incidental Mutation 'R9483:Rpe65'

716349

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.191) question?

Stock #

R9483 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 159622681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 405 (P405S)

Ref Sequence

ENSEMBL: ENSMUSP00000029824 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]

AlphaFold

Q91ZQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000029824
AA Change: P405S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: P405S

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000196999
AA Change: P405S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: P405S

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	G	1: 37,631,415	E148A	probably damaging	Het
2900026A02Rik	A	T	5: 113,191,144	M334K	probably benign	Het
Abca1	A	T	4: 53,060,351	I1525N	probably benign	Het
Abca4	A	T	3: 122,085,626	I398F		Het
Acbd3	A	G	1: 180,745,156	D327G	probably benign	Het
Acsm3	A	G	7: 119,783,943	T544A	probably damaging	Het
Atp11a	C	T	8: 12,851,087	T972M	probably damaging	Het
Cbfb	C	T	8: 105,202,491	R147*	probably null	Het
Ccdc17	G	T	4: 116,596,947	R54L	probably benign	Het
Cuedc2	G	T	19: 46,330,960	A223E	probably benign	Het
Cul5	T	C	9: 53,621,174	I787V	probably benign	Het
D430041D05Rik	T	A	2: 104,257,218	H471L	probably benign	Het
Ddx39	T	C	8: 83,722,287	Y264H	probably benign	Het
Dlgap3	C	A	4: 127,233,872	R778S	probably damaging	Het
Esrrg	T	C	1: 188,198,651	V313A	probably damaging	Het
Fam124a	T	C	14: 62,606,651	I536T	probably damaging	Het
Fbxo21	T	C	5: 117,989,207	F275L	possibly damaging	Het
Gabrg1	C	A	5: 70,842,215	G2V	possibly damaging	Het
Gcc1	G	T	6: 28,418,090	A748D	probably damaging	Het
Gjb6	T	C	14: 57,124,054	D250G	probably benign	Het
Gm44501	A	T	17: 40,578,981	K129*	probably null	Het
Hmcn2	T	G	2: 31,430,363	L3952R		Het
Hpd	A	G	5: 123,174,472	I278T	probably damaging	Het
Igsf3	T	C	3: 101,439,501	F584S	probably damaging	Het
Igsf3	T	A	3: 101,439,588	F613Y	probably damaging	Het
Ik	A	G	18: 36,753,582	D369G	probably benign	Het
Ikbke	A	G	1: 131,270,982	L365P	probably damaging	Het
Il22ra2	A	T	10: 19,632,794	Q190L	possibly damaging	Het
Itga6	T	C	2: 71,849,490	V1033A	probably benign	Het
Kif18a	T	C	2: 109,289,687	Y112H	probably damaging	Het
Krt75	T	C	15: 101,573,803	H10R	probably benign	Het
L3mbtl1	T	A	2: 162,948,814	L93H	probably benign	Het
Lrfn1	G	A	7: 28,458,758	C34Y	probably damaging	Het
Lrrc47	A	T	4: 154,017,463	I396F	probably damaging	Het
Mgat3	T	A	15: 80,211,440	V156E	probably benign	Het
Mtus2	A	G	5: 148,295,490	D1120G	possibly damaging	Het
Muc5ac	G	T	7: 141,811,728	E2700*	probably null	Het
Nxpe5	A	T	5: 138,230,329		probably benign	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr621-ps1	T	C	7: 103,629,724	T79A	probably damaging	Het
Pcdhga4	T	A	18: 37,686,693	S432T	possibly damaging	Het
Pdk4	T	A	6: 5,486,716	M353L	probably benign	Het
Ppp1r13b	T	A	12: 111,833,776	K645N	probably benign	Het
Ppt1	A	T	4: 122,857,574	D288V	possibly damaging	Het
Prkcb	A	G	7: 122,582,440	Y417C	probably damaging	Het
Prss22	A	G	17: 23,996,747	I67T	probably damaging	Het
Rab29	T	C	1: 131,867,770	V40A	possibly damaging	Het
Rae1	T	C	2: 173,008,148		probably null	Het
Rasa3	C	T	8: 13,580,033		probably null	Het
Rasgrp3	A	G	17: 75,500,722	D258G	probably benign	Het
Rcc1	T	A	4: 132,335,497	T208S	probably benign	Het
Rgs3	C	A	4: 62,657,117	Y580*	probably null	Het
Rsf1	GGCGGC	GGCGGCGGCAGCGGC	7: 97,579,930		probably benign	Het
Rsph4a	A	G	10: 33,914,422	E669G	probably damaging	Het
Rusc1	A	T	3: 89,086,806	V964E	probably benign	Het
Rusc2	A	G	4: 43,415,897	N401S	probably damaging	Het
Slc10a1	G	T	12: 80,956,090	T258K	probably damaging	Het
Slc5a9	A	G	4: 111,890,221	L323P	probably damaging	Het
Slc6a17	T	A	3: 107,471,456	I637F	possibly damaging	Het
Slc8a2	A	G	7: 16,152,855	E641G	possibly damaging	Het
Sptbn2	G	T	19: 4,739,946	A1321S	probably damaging	Het
Ssh2	G	T	11: 77,393,150	A77S	possibly damaging	Het
St13	G	T	15: 81,366,386	N316K	probably damaging	Het
Taf10	A	G	7: 105,743,855	M121T	probably benign	Het
Tcta	T	C	9: 108,305,743	T68A	probably damaging	Het
Timd2	A	T	11: 46,687,062	Y81N	probably damaging	Het
Tln2	T	C	9: 67,392,487	E161G	probably damaging	Het
Tmed10	T	C	12: 85,350,847	I123V	probably benign	Het
Ttf1	T	C	2: 29,079,480		probably null	Het
Tubg1	A	G	11: 101,126,060	D396G	probably damaging	Het
Uhmk1	A	G	1: 170,207,344		probably null	Het
Unc13a	C	T	8: 71,650,577	A922T	probably benign	Het
Usp24	T	A	4: 106,362,182	V525E	probably damaging	Het
Usp28	C	A	9: 49,035,737	Q823K	probably damaging	Het
Vldlr	A	T	19: 27,246,631	I764F	probably benign	Het
Vmn2r88	T	C	14: 51,411,184	Y62H		Het
Zfp423	T	A	8: 87,781,097	N873I	possibly damaging	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTAACCAGTCTCCTTGTCTG -3'
(R):5'- TCAACCCAAGTCCGTATGC -3'

Sequencing Primer
(F):5'- CCTTAAATGGTGACCTCTGAAAAGAG -3'
(R):5'- CCGTATGCATAAGTATAAGGTTTCCC -3'

Posted On

2022-07-18