Incidental Mutation 'R9483:Acsm3'
ID 716373
Institutional Source Beutler Lab
Gene Symbol Acsm3
Ensembl Gene ENSMUSG00000030935
Gene Name acyl-CoA synthetase medium-chain family member 3
Synonyms Sah, Sa
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9483 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 119760923-119787513 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119783943 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 544 (T544A)
Ref Sequence ENSEMBL: ENSMUSP00000102139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033224] [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529] [ENSMUST00000139192] [ENSMUST00000150844]
AlphaFold Q3UNX5
Predicted Effect probably benign
Transcript: ENSMUST00000033224
Predicted Effect possibly damaging
Transcript: ENSMUST00000063770
AA Change: T544A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935
AA Change: T544A

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106526
AA Change: T544A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935
AA Change: T544A

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106527
AA Change: T544A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935
AA Change: T544A

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106528
AA Change: T544A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935
AA Change: T544A

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106529
AA Change: T544A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935
AA Change: T544A

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139192
SMART Domains Protein: ENSMUSP00000117940
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
Pfam:RNase_T 21 160 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150844
SMART Domains Protein: ENSMUSP00000120547
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
low complexity region 362 381 N/A INTRINSIC
Pfam:zf-GRF 592 640 1.4e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with normal kidney function and morphology and blood pressure similar to wild-type on either a regular or high salt diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T G 1: 37,631,415 E148A probably damaging Het
2900026A02Rik A T 5: 113,191,144 M334K probably benign Het
Abca1 A T 4: 53,060,351 I1525N probably benign Het
Abca4 A T 3: 122,085,626 I398F Het
Acbd3 A G 1: 180,745,156 D327G probably benign Het
Atp11a C T 8: 12,851,087 T972M probably damaging Het
Cbfb C T 8: 105,202,491 R147* probably null Het
Ccdc17 G T 4: 116,596,947 R54L probably benign Het
Cuedc2 G T 19: 46,330,960 A223E probably benign Het
Cul5 T C 9: 53,621,174 I787V probably benign Het
D430041D05Rik T A 2: 104,257,218 H471L probably benign Het
Ddx39 T C 8: 83,722,287 Y264H probably benign Het
Dlgap3 C A 4: 127,233,872 R778S probably damaging Het
Esrrg T C 1: 188,198,651 V313A probably damaging Het
Fam124a T C 14: 62,606,651 I536T probably damaging Het
Fbxo21 T C 5: 117,989,207 F275L possibly damaging Het
Gabrg1 C A 5: 70,842,215 G2V possibly damaging Het
Gcc1 G T 6: 28,418,090 A748D probably damaging Het
Gjb6 T C 14: 57,124,054 D250G probably benign Het
Gm44501 A T 17: 40,578,981 K129* probably null Het
Hmcn2 T G 2: 31,430,363 L3952R Het
Hpd A G 5: 123,174,472 I278T probably damaging Het
Igsf3 T C 3: 101,439,501 F584S probably damaging Het
Igsf3 T A 3: 101,439,588 F613Y probably damaging Het
Ik A G 18: 36,753,582 D369G probably benign Het
Ikbke A G 1: 131,270,982 L365P probably damaging Het
Il22ra2 A T 10: 19,632,794 Q190L possibly damaging Het
Itga6 T C 2: 71,849,490 V1033A probably benign Het
Kif18a T C 2: 109,289,687 Y112H probably damaging Het
Krt75 T C 15: 101,573,803 H10R probably benign Het
L3mbtl1 T A 2: 162,948,814 L93H probably benign Het
Lrfn1 G A 7: 28,458,758 C34Y probably damaging Het
Lrrc47 A T 4: 154,017,463 I396F probably damaging Het
Mgat3 T A 15: 80,211,440 V156E probably benign Het
Mtus2 A G 5: 148,295,490 D1120G possibly damaging Het
Muc5ac G T 7: 141,811,728 E2700* probably null Het
Nxpe5 A T 5: 138,230,329 probably benign Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr621-ps1 T C 7: 103,629,724 T79A probably damaging Het
Pcdhga4 T A 18: 37,686,693 S432T possibly damaging Het
Pdk4 T A 6: 5,486,716 M353L probably benign Het
Ppp1r13b T A 12: 111,833,776 K645N probably benign Het
Ppt1 A T 4: 122,857,574 D288V possibly damaging Het
Prkcb A G 7: 122,582,440 Y417C probably damaging Het
Prss22 A G 17: 23,996,747 I67T probably damaging Het
Rab29 T C 1: 131,867,770 V40A possibly damaging Het
Rae1 T C 2: 173,008,148 probably null Het
Rasa3 C T 8: 13,580,033 probably null Het
Rasgrp3 A G 17: 75,500,722 D258G probably benign Het
Rcc1 T A 4: 132,335,497 T208S probably benign Het
Rgs3 C A 4: 62,657,117 Y580* probably null Het
Rpe65 C T 3: 159,622,681 P405S probably damaging Het
Rsf1 GGCGGC GGCGGCGGCAGCGGC 7: 97,579,930 probably benign Het
Rsph4a A G 10: 33,914,422 E669G probably damaging Het
Rusc1 A T 3: 89,086,806 V964E probably benign Het
Rusc2 A G 4: 43,415,897 N401S probably damaging Het
Slc10a1 G T 12: 80,956,090 T258K probably damaging Het
Slc5a9 A G 4: 111,890,221 L323P probably damaging Het
Slc6a17 T A 3: 107,471,456 I637F possibly damaging Het
Slc8a2 A G 7: 16,152,855 E641G possibly damaging Het
Sptbn2 G T 19: 4,739,946 A1321S probably damaging Het
Ssh2 G T 11: 77,393,150 A77S possibly damaging Het
St13 G T 15: 81,366,386 N316K probably damaging Het
Taf10 A G 7: 105,743,855 M121T probably benign Het
Tcta T C 9: 108,305,743 T68A probably damaging Het
Timd2 A T 11: 46,687,062 Y81N probably damaging Het
Tln2 T C 9: 67,392,487 E161G probably damaging Het
Tmed10 T C 12: 85,350,847 I123V probably benign Het
Ttf1 T C 2: 29,079,480 probably null Het
Tubg1 A G 11: 101,126,060 D396G probably damaging Het
Uhmk1 A G 1: 170,207,344 probably null Het
Unc13a C T 8: 71,650,577 A922T probably benign Het
Usp24 T A 4: 106,362,182 V525E probably damaging Het
Usp28 C A 9: 49,035,737 Q823K probably damaging Het
Vldlr A T 19: 27,246,631 I764F probably benign Het
Vmn2r88 T C 14: 51,411,184 Y62H Het
Zfp423 T A 8: 87,781,097 N873I possibly damaging Het
Other mutations in Acsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Acsm3 APN 7 119784344 missense probably damaging 1.00
IGL01434:Acsm3 APN 7 119781074 unclassified probably benign
IGL01446:Acsm3 APN 7 119778454 missense probably damaging 1.00
IGL01800:Acsm3 APN 7 119774643 missense possibly damaging 0.68
IGL01882:Acsm3 APN 7 119774635 missense probably damaging 0.99
IGL01954:Acsm3 APN 7 119775083 splice site probably benign
PIT4677001:Acsm3 UTSW 7 119775117 missense probably damaging 1.00
PIT4696001:Acsm3 UTSW 7 119784986 splice site probably null
R0422:Acsm3 UTSW 7 119773740 nonsense probably null
R0423:Acsm3 UTSW 7 119777159 missense probably damaging 1.00
R0729:Acsm3 UTSW 7 119783984 utr 3 prime probably benign
R0731:Acsm3 UTSW 7 119768024 nonsense probably null
R0732:Acsm3 UTSW 7 119773834 missense probably benign 0.40
R0744:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R0836:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R1926:Acsm3 UTSW 7 119777136 missense probably damaging 1.00
R2104:Acsm3 UTSW 7 119784304 missense probably benign
R2429:Acsm3 UTSW 7 119768000 missense probably benign
R3940:Acsm3 UTSW 7 119773886 missense probably benign 0.03
R4386:Acsm3 UTSW 7 119773871 missense probably damaging 1.00
R5437:Acsm3 UTSW 7 119778497 intron probably benign
R5890:Acsm3 UTSW 7 119775234 missense probably benign
R6278:Acsm3 UTSW 7 119773849 missense probably damaging 1.00
R6350:Acsm3 UTSW 7 119768033 missense probably benign
R6497:Acsm3 UTSW 7 119780749 critical splice acceptor site probably null
R6582:Acsm3 UTSW 7 119779673 missense probably benign
R6670:Acsm3 UTSW 7 119780755 splice site probably null
R6939:Acsm3 UTSW 7 119778455 missense probably damaging 1.00
R7037:Acsm3 UTSW 7 119768043 missense probably damaging 1.00
R7087:Acsm3 UTSW 7 119774647 missense probably damaging 1.00
R7301:Acsm3 UTSW 7 119777085 missense possibly damaging 0.92
R7381:Acsm3 UTSW 7 119780826 missense probably damaging 0.98
R7396:Acsm3 UTSW 7 119773829 missense probably damaging 1.00
R7594:Acsm3 UTSW 7 119784990 splice site probably null
R8676:Acsm3 UTSW 7 119775169 missense probably damaging 1.00
R9026:Acsm3 UTSW 7 119774622 missense probably benign 0.29
R9221:Acsm3 UTSW 7 119768908 nonsense probably null
R9283:Acsm3 UTSW 7 119773892 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GATTCCCACTCAGAGAAAGCAG -3'
(R):5'- CCGGTTACTCAAGAGCTCTG -3'

Sequencing Primer
(F):5'- TTCCCACTCAGAGAAAGCAGACAAG -3'
(R):5'- CAAGAGCTCTGTTTCAAACTCTAGG -3'
Posted On 2022-07-18