Incidental Mutation 'R9483:Prkcb'
ID 716374
Institutional Source Beutler Lab
Gene Symbol Prkcb
Ensembl Gene ENSMUSG00000052889
Gene Name protein kinase C, beta
Synonyms Pkcb, Prkcb2, Prkcb1, A130082F03Rik, PKC-Beta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9483 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 122288751-122634402 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122582440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 417 (Y417C)
Ref Sequence ENSEMBL: ENSMUSP00000070019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064921] [ENSMUST00000064989] [ENSMUST00000143692]
AlphaFold P68404
Predicted Effect probably damaging
Transcript: ENSMUST00000064921
AA Change: Y417C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064812
Gene: ENSMUSG00000052889
AA Change: Y417C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 664 9.86e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064989
AA Change: Y417C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: Y417C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143692
AA Change: Y417C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138788
Gene: ENSMUSG00000052889
AA Change: Y417C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T G 1: 37,631,415 E148A probably damaging Het
2900026A02Rik A T 5: 113,191,144 M334K probably benign Het
Abca1 A T 4: 53,060,351 I1525N probably benign Het
Abca4 A T 3: 122,085,626 I398F Het
Acbd3 A G 1: 180,745,156 D327G probably benign Het
Acsm3 A G 7: 119,783,943 T544A probably damaging Het
Atp11a C T 8: 12,851,087 T972M probably damaging Het
Cbfb C T 8: 105,202,491 R147* probably null Het
Ccdc17 G T 4: 116,596,947 R54L probably benign Het
Cuedc2 G T 19: 46,330,960 A223E probably benign Het
Cul5 T C 9: 53,621,174 I787V probably benign Het
D430041D05Rik T A 2: 104,257,218 H471L probably benign Het
Ddx39 T C 8: 83,722,287 Y264H probably benign Het
Dlgap3 C A 4: 127,233,872 R778S probably damaging Het
Esrrg T C 1: 188,198,651 V313A probably damaging Het
Fam124a T C 14: 62,606,651 I536T probably damaging Het
Fbxo21 T C 5: 117,989,207 F275L possibly damaging Het
Gabrg1 C A 5: 70,842,215 G2V possibly damaging Het
Gcc1 G T 6: 28,418,090 A748D probably damaging Het
Gjb6 T C 14: 57,124,054 D250G probably benign Het
Gm44501 A T 17: 40,578,981 K129* probably null Het
Hmcn2 T G 2: 31,430,363 L3952R Het
Hpd A G 5: 123,174,472 I278T probably damaging Het
Igsf3 T C 3: 101,439,501 F584S probably damaging Het
Igsf3 T A 3: 101,439,588 F613Y probably damaging Het
Ik A G 18: 36,753,582 D369G probably benign Het
Ikbke A G 1: 131,270,982 L365P probably damaging Het
Il22ra2 A T 10: 19,632,794 Q190L possibly damaging Het
Itga6 T C 2: 71,849,490 V1033A probably benign Het
Kif18a T C 2: 109,289,687 Y112H probably damaging Het
Krt75 T C 15: 101,573,803 H10R probably benign Het
L3mbtl1 T A 2: 162,948,814 L93H probably benign Het
Lrfn1 G A 7: 28,458,758 C34Y probably damaging Het
Lrrc47 A T 4: 154,017,463 I396F probably damaging Het
Mgat3 T A 15: 80,211,440 V156E probably benign Het
Mtus2 A G 5: 148,295,490 D1120G possibly damaging Het
Muc5ac G T 7: 141,811,728 E2700* probably null Het
Nxpe5 A T 5: 138,230,329 probably benign Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr621-ps1 T C 7: 103,629,724 T79A probably damaging Het
Pcdhga4 T A 18: 37,686,693 S432T possibly damaging Het
Pdk4 T A 6: 5,486,716 M353L probably benign Het
Ppp1r13b T A 12: 111,833,776 K645N probably benign Het
Ppt1 A T 4: 122,857,574 D288V possibly damaging Het
Prss22 A G 17: 23,996,747 I67T probably damaging Het
Rab29 T C 1: 131,867,770 V40A possibly damaging Het
Rae1 T C 2: 173,008,148 probably null Het
Rasa3 C T 8: 13,580,033 probably null Het
Rasgrp3 A G 17: 75,500,722 D258G probably benign Het
Rcc1 T A 4: 132,335,497 T208S probably benign Het
Rgs3 C A 4: 62,657,117 Y580* probably null Het
Rpe65 C T 3: 159,622,681 P405S probably damaging Het
Rsf1 GGCGGC GGCGGCGGCAGCGGC 7: 97,579,930 probably benign Het
Rsph4a A G 10: 33,914,422 E669G probably damaging Het
Rusc1 A T 3: 89,086,806 V964E probably benign Het
Rusc2 A G 4: 43,415,897 N401S probably damaging Het
Slc10a1 G T 12: 80,956,090 T258K probably damaging Het
Slc5a9 A G 4: 111,890,221 L323P probably damaging Het
Slc6a17 T A 3: 107,471,456 I637F possibly damaging Het
Slc8a2 A G 7: 16,152,855 E641G possibly damaging Het
Sptbn2 G T 19: 4,739,946 A1321S probably damaging Het
Ssh2 G T 11: 77,393,150 A77S possibly damaging Het
St13 G T 15: 81,366,386 N316K probably damaging Het
Taf10 A G 7: 105,743,855 M121T probably benign Het
Tcta T C 9: 108,305,743 T68A probably damaging Het
Timd2 A T 11: 46,687,062 Y81N probably damaging Het
Tln2 T C 9: 67,392,487 E161G probably damaging Het
Tmed10 T C 12: 85,350,847 I123V probably benign Het
Ttf1 T C 2: 29,079,480 probably null Het
Tubg1 A G 11: 101,126,060 D396G probably damaging Het
Uhmk1 A G 1: 170,207,344 probably null Het
Unc13a C T 8: 71,650,577 A922T probably benign Het
Usp24 T A 4: 106,362,182 V525E probably damaging Het
Usp28 C A 9: 49,035,737 Q823K probably damaging Het
Vldlr A T 19: 27,246,631 I764F probably benign Het
Vmn2r88 T C 14: 51,411,184 Y62H Het
Zfp423 T A 8: 87,781,097 N873I possibly damaging Het
Other mutations in Prkcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
tilcara APN 7 122595005 missense probably damaging 1.00
IGL02045:Prkcb APN 7 122590167 missense probably damaging 1.00
IGL02273:Prkcb APN 7 122627767 missense probably damaging 1.00
IGL02638:Prkcb APN 7 122600840 splice site probably benign
IGL02962:Prkcb APN 7 122425047 splice site probably null
IGL03013:Prkcb APN 7 122627682 missense probably damaging 1.00
IGL03224:Prkcb APN 7 122516924 nonsense probably null
Almonde UTSW 7 122582449 missense probably damaging 1.00
Baghdad UTSW 7 122627663 missense probably benign 0.07
Mesopotamia UTSW 7 122289514 missense probably damaging 1.00
Mosul UTSW 7 122516844 missense probably damaging 1.00
tigris UTSW 7 122424977 missense probably damaging 1.00
Tikrit UTSW 7 122627693 missense probably damaging 1.00
untied UTSW 7 122582439 missense possibly damaging 0.90
F5770:Prkcb UTSW 7 122528476 missense probably damaging 0.99
R0078:Prkcb UTSW 7 122590170 missense probably damaging 1.00
R0409:Prkcb UTSW 7 122424977 missense probably damaging 1.00
R0660:Prkcb UTSW 7 122424959 missense possibly damaging 0.56
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1480:Prkcb UTSW 7 122594642 missense probably damaging 1.00
R1518:Prkcb UTSW 7 122544631 critical splice acceptor site probably null
R1540:Prkcb UTSW 7 122627693 missense probably damaging 1.00
R1860:Prkcb UTSW 7 122568201 missense probably damaging 1.00
R3110:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R3112:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R4583:Prkcb UTSW 7 122457224 missense probably benign 0.32
R4847:Prkcb UTSW 7 122568149 missense probably benign 0.35
R5220:Prkcb UTSW 7 122289455 missense probably damaging 1.00
R5487:Prkcb UTSW 7 122600725 nonsense probably null
R5599:Prkcb UTSW 7 122582478 missense probably benign 0.17
R5946:Prkcb UTSW 7 122544703 missense probably benign
R6257:Prkcb UTSW 7 122568163 missense probably benign
R6590:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6618:Prkcb UTSW 7 122627663 missense probably benign 0.07
R6690:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6763:Prkcb UTSW 7 122594664 missense probably damaging 1.00
R7289:Prkcb UTSW 7 122544687 missense probably benign 0.04
R7414:Prkcb UTSW 7 122568227 missense possibly damaging 0.83
R7466:Prkcb UTSW 7 122516844 missense probably damaging 1.00
R7540:Prkcb UTSW 7 122568134 missense probably damaging 0.99
R8283:Prkcb UTSW 7 122600725 nonsense probably null
R9072:Prkcb UTSW 7 122528548 missense probably benign 0.14
R9670:Prkcb UTSW 7 122633847 nonsense probably null
V7581:Prkcb UTSW 7 122528476 missense probably damaging 0.99
X0061:Prkcb UTSW 7 122457306 missense probably benign 0.03
Z1177:Prkcb UTSW 7 122568196 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TACAGTGGCTCAGAGGTCAC -3'
(R):5'- CAGAATACAGTTGTCCTTGGCC -3'

Sequencing Primer
(F):5'- TGGCTCAGAGGTCACCCTTAG -3'
(R):5'- CAGTTGTCCTTGGCCAAATAACG -3'
Posted On 2022-07-18