Incidental Mutation 'R9483:Rasgrp3'
ID 716402
Institutional Source Beutler Lab
Gene Symbol Rasgrp3
Ensembl Gene ENSMUSG00000071042
Gene Name RAS, guanyl releasing protein 3
Synonyms LOC240168
Accession Numbers

Ncbi RefSeq: NM_207246.4, NM_001166493.1; MGI:3028579

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9483 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 75435905-75529043 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75500722 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 258 (D258G)
Ref Sequence ENSEMBL: ENSMUSP00000092828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095204] [ENSMUST00000164192]
AlphaFold Q6NZH9
Predicted Effect probably benign
Transcript: ENSMUST00000095204
AA Change: D258G

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092828
Gene: ENSMUSG00000071042
AA Change: D258G

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164192
AA Change: D258G

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129393
Gene: ENSMUSG00000071042
AA Change: D258G

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype Strain: 3625862; 3525522
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RASGRP3, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with no obvious abnormalities in the kidneys or vasculature. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T G 1: 37,631,415 E148A probably damaging Het
2900026A02Rik A T 5: 113,191,144 M334K probably benign Het
Abca1 A T 4: 53,060,351 I1525N probably benign Het
Abca4 A T 3: 122,085,626 I398F Het
Acbd3 A G 1: 180,745,156 D327G probably benign Het
Acsm3 A G 7: 119,783,943 T544A probably damaging Het
Atp11a C T 8: 12,851,087 T972M probably damaging Het
Cbfb C T 8: 105,202,491 R147* probably null Het
Ccdc17 G T 4: 116,596,947 R54L probably benign Het
Cuedc2 G T 19: 46,330,960 A223E probably benign Het
Cul5 T C 9: 53,621,174 I787V probably benign Het
D430041D05Rik T A 2: 104,257,218 H471L probably benign Het
Ddx39 T C 8: 83,722,287 Y264H probably benign Het
Dlgap3 C A 4: 127,233,872 R778S probably damaging Het
Esrrg T C 1: 188,198,651 V313A probably damaging Het
Fam124a T C 14: 62,606,651 I536T probably damaging Het
Fbxo21 T C 5: 117,989,207 F275L possibly damaging Het
Gabrg1 C A 5: 70,842,215 G2V possibly damaging Het
Gcc1 G T 6: 28,418,090 A748D probably damaging Het
Gjb6 T C 14: 57,124,054 D250G probably benign Het
Gm44501 A T 17: 40,578,981 K129* probably null Het
Hmcn2 T G 2: 31,430,363 L3952R Het
Hpd A G 5: 123,174,472 I278T probably damaging Het
Igsf3 T C 3: 101,439,501 F584S probably damaging Het
Igsf3 T A 3: 101,439,588 F613Y probably damaging Het
Ik A G 18: 36,753,582 D369G probably benign Het
Ikbke A G 1: 131,270,982 L365P probably damaging Het
Il22ra2 A T 10: 19,632,794 Q190L possibly damaging Het
Itga6 T C 2: 71,849,490 V1033A probably benign Het
Kif18a T C 2: 109,289,687 Y112H probably damaging Het
Krt75 T C 15: 101,573,803 H10R probably benign Het
L3mbtl1 T A 2: 162,948,814 L93H probably benign Het
Lrfn1 G A 7: 28,458,758 C34Y probably damaging Het
Lrrc47 A T 4: 154,017,463 I396F probably damaging Het
Mgat3 T A 15: 80,211,440 V156E probably benign Het
Mtus2 A G 5: 148,295,490 D1120G possibly damaging Het
Muc5ac G T 7: 141,811,728 E2700* probably null Het
Nxpe5 A T 5: 138,230,329 probably benign Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr621-ps1 T C 7: 103,629,724 T79A probably damaging Het
Pcdhga4 T A 18: 37,686,693 S432T possibly damaging Het
Pdk4 T A 6: 5,486,716 M353L probably benign Het
Ppp1r13b T A 12: 111,833,776 K645N probably benign Het
Ppt1 A T 4: 122,857,574 D288V possibly damaging Het
Prkcb A G 7: 122,582,440 Y417C probably damaging Het
Prss22 A G 17: 23,996,747 I67T probably damaging Het
Rab29 T C 1: 131,867,770 V40A possibly damaging Het
Rae1 T C 2: 173,008,148 probably null Het
Rasa3 C T 8: 13,580,033 probably null Het
Rcc1 T A 4: 132,335,497 T208S probably benign Het
Rgs3 C A 4: 62,657,117 Y580* probably null Het
Rpe65 C T 3: 159,622,681 P405S probably damaging Het
Rsf1 GGCGGC GGCGGCGGCAGCGGC 7: 97,579,930 probably benign Het
Rsph4a A G 10: 33,914,422 E669G probably damaging Het
Rusc1 A T 3: 89,086,806 V964E probably benign Het
Rusc2 A G 4: 43,415,897 N401S probably damaging Het
Slc10a1 G T 12: 80,956,090 T258K probably damaging Het
Slc5a9 A G 4: 111,890,221 L323P probably damaging Het
Slc6a17 T A 3: 107,471,456 I637F possibly damaging Het
Slc8a2 A G 7: 16,152,855 E641G possibly damaging Het
Sptbn2 G T 19: 4,739,946 A1321S probably damaging Het
Ssh2 G T 11: 77,393,150 A77S possibly damaging Het
St13 G T 15: 81,366,386 N316K probably damaging Het
Taf10 A G 7: 105,743,855 M121T probably benign Het
Tcta T C 9: 108,305,743 T68A probably damaging Het
Timd2 A T 11: 46,687,062 Y81N probably damaging Het
Tln2 T C 9: 67,392,487 E161G probably damaging Het
Tmed10 T C 12: 85,350,847 I123V probably benign Het
Ttf1 T C 2: 29,079,480 probably null Het
Tubg1 A G 11: 101,126,060 D396G probably damaging Het
Uhmk1 A G 1: 170,207,344 probably null Het
Unc13a C T 8: 71,650,577 A922T probably benign Het
Usp24 T A 4: 106,362,182 V525E probably damaging Het
Usp28 C A 9: 49,035,737 Q823K probably damaging Het
Vldlr A T 19: 27,246,631 I764F probably benign Het
Vmn2r88 T C 14: 51,411,184 Y62H Het
Zfp423 T A 8: 87,781,097 N873I possibly damaging Het
Other mutations in Rasgrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Rasgrp3 APN 17 75516373 missense probably benign 0.00
IGL02529:Rasgrp3 APN 17 75525102 missense possibly damaging 0.84
IGL02672:Rasgrp3 APN 17 75496417 missense probably benign 0.00
IGL02935:Rasgrp3 APN 17 75497070 missense probably benign 0.00
Aster UTSW 17 75509827 splice site probably null
aston UTSW 17 75500758 critical splice donor site probably null
centre UTSW 17 75500734 missense possibly damaging 0.50
P0021:Rasgrp3 UTSW 17 75500713 missense probably damaging 1.00
PIT4243001:Rasgrp3 UTSW 17 75500139 missense probably damaging 1.00
R0090:Rasgrp3 UTSW 17 75498461 missense probably damaging 1.00
R0907:Rasgrp3 UTSW 17 75509827 splice site probably null
R1182:Rasgrp3 UTSW 17 75503190 missense probably benign 0.01
R1412:Rasgrp3 UTSW 17 75509827 splice site probably null
R1572:Rasgrp3 UTSW 17 75500734 missense possibly damaging 0.50
R1664:Rasgrp3 UTSW 17 75524177 missense probably damaging 1.00
R2094:Rasgrp3 UTSW 17 75503141 missense probably damaging 1.00
R2111:Rasgrp3 UTSW 17 75500758 critical splice donor site probably null
R3026:Rasgrp3 UTSW 17 75524921 missense possibly damaging 0.52
R4052:Rasgrp3 UTSW 17 75496968 missense probably damaging 1.00
R4348:Rasgrp3 UTSW 17 75511980 missense probably benign 0.00
R4509:Rasgrp3 UTSW 17 75500673 missense probably damaging 1.00
R4642:Rasgrp3 UTSW 17 75498448 missense possibly damaging 0.64
R4791:Rasgrp3 UTSW 17 75500173 missense probably benign 0.37
R4901:Rasgrp3 UTSW 17 75514116 nonsense probably null
R4927:Rasgrp3 UTSW 17 75516355 missense probably benign 0.00
R5410:Rasgrp3 UTSW 17 75497047 missense probably benign 0.01
R5444:Rasgrp3 UTSW 17 75503375 missense probably damaging 0.99
R5483:Rasgrp3 UTSW 17 75525018 missense probably damaging 1.00
R5518:Rasgrp3 UTSW 17 75516359 missense probably benign 0.36
R5755:Rasgrp3 UTSW 17 75524945 missense probably benign 0.44
R5845:Rasgrp3 UTSW 17 75503147 missense possibly damaging 0.61
R6310:Rasgrp3 UTSW 17 75494209 missense probably damaging 1.00
R6604:Rasgrp3 UTSW 17 75503115 missense probably benign 0.10
R6826:Rasgrp3 UTSW 17 75503246 missense probably damaging 1.00
R7409:Rasgrp3 UTSW 17 75516416 missense possibly damaging 0.48
R7507:Rasgrp3 UTSW 17 75497060 missense probably damaging 1.00
R7536:Rasgrp3 UTSW 17 75514133 missense probably damaging 1.00
R7538:Rasgrp3 UTSW 17 75496416 missense probably benign
R8089:Rasgrp3 UTSW 17 75497061 missense possibly damaging 0.54
R8677:Rasgrp3 UTSW 17 75512060 missense probably benign 0.00
R9521:Rasgrp3 UTSW 17 75514163 missense probably null 1.00
R9557:Rasgrp3 UTSW 17 75500144 missense probably damaging 0.98
R9727:Rasgrp3 UTSW 17 75503244 missense probably damaging 1.00
R9757:Rasgrp3 UTSW 17 75500724 missense probably damaging 1.00
X0011:Rasgrp3 UTSW 17 75525166 nonsense probably null
Z1177:Rasgrp3 UTSW 17 75512095 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCACCTGCAACTTGGAAAATCC -3'
(R):5'- CAGCAATCTGGTTTGATGGG -3'

Sequencing Primer
(F):5'- ACCATGTGTTAGTGTTAATGGT -3'
(R):5'- CTTGGACAATGGGGCTAGTCC -3'
Posted On 2022-07-18