Incidental Mutation 'R9483:Sptbn2'
ID 716405
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Name spectrin beta, non-erythrocytic 2
Synonyms Spnb3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9483 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 4711208-4752353 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 4739946 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 1321 (A1321S)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]
AlphaFold Q68FG2
Predicted Effect probably damaging
Transcript: ENSMUST00000008991
AA Change: A1321S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: A1321S

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T G 1: 37,631,415 E148A probably damaging Het
2900026A02Rik A T 5: 113,191,144 M334K probably benign Het
Abca1 A T 4: 53,060,351 I1525N probably benign Het
Abca4 A T 3: 122,085,626 I398F Het
Acbd3 A G 1: 180,745,156 D327G probably benign Het
Acsm3 A G 7: 119,783,943 T544A probably damaging Het
Atp11a C T 8: 12,851,087 T972M probably damaging Het
Cbfb C T 8: 105,202,491 R147* probably null Het
Ccdc17 G T 4: 116,596,947 R54L probably benign Het
Cuedc2 G T 19: 46,330,960 A223E probably benign Het
Cul5 T C 9: 53,621,174 I787V probably benign Het
D430041D05Rik T A 2: 104,257,218 H471L probably benign Het
Ddx39 T C 8: 83,722,287 Y264H probably benign Het
Dlgap3 C A 4: 127,233,872 R778S probably damaging Het
Esrrg T C 1: 188,198,651 V313A probably damaging Het
Fam124a T C 14: 62,606,651 I536T probably damaging Het
Fbxo21 T C 5: 117,989,207 F275L possibly damaging Het
Gabrg1 C A 5: 70,842,215 G2V possibly damaging Het
Gcc1 G T 6: 28,418,090 A748D probably damaging Het
Gjb6 T C 14: 57,124,054 D250G probably benign Het
Gm44501 A T 17: 40,578,981 K129* probably null Het
Hmcn2 T G 2: 31,430,363 L3952R Het
Hpd A G 5: 123,174,472 I278T probably damaging Het
Igsf3 T C 3: 101,439,501 F584S probably damaging Het
Igsf3 T A 3: 101,439,588 F613Y probably damaging Het
Ik A G 18: 36,753,582 D369G probably benign Het
Ikbke A G 1: 131,270,982 L365P probably damaging Het
Il22ra2 A T 10: 19,632,794 Q190L possibly damaging Het
Itga6 T C 2: 71,849,490 V1033A probably benign Het
Kif18a T C 2: 109,289,687 Y112H probably damaging Het
Krt75 T C 15: 101,573,803 H10R probably benign Het
L3mbtl1 T A 2: 162,948,814 L93H probably benign Het
Lrfn1 G A 7: 28,458,758 C34Y probably damaging Het
Lrrc47 A T 4: 154,017,463 I396F probably damaging Het
Mgat3 T A 15: 80,211,440 V156E probably benign Het
Mtus2 A G 5: 148,295,490 D1120G possibly damaging Het
Muc5ac G T 7: 141,811,728 E2700* probably null Het
Nxpe5 A T 5: 138,230,329 probably benign Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr621-ps1 T C 7: 103,629,724 T79A probably damaging Het
Pcdhga4 T A 18: 37,686,693 S432T possibly damaging Het
Pdk4 T A 6: 5,486,716 M353L probably benign Het
Ppp1r13b T A 12: 111,833,776 K645N probably benign Het
Ppt1 A T 4: 122,857,574 D288V possibly damaging Het
Prkcb A G 7: 122,582,440 Y417C probably damaging Het
Prss22 A G 17: 23,996,747 I67T probably damaging Het
Rab29 T C 1: 131,867,770 V40A possibly damaging Het
Rae1 T C 2: 173,008,148 probably null Het
Rasa3 C T 8: 13,580,033 probably null Het
Rasgrp3 A G 17: 75,500,722 D258G probably benign Het
Rcc1 T A 4: 132,335,497 T208S probably benign Het
Rgs3 C A 4: 62,657,117 Y580* probably null Het
Rpe65 C T 3: 159,622,681 P405S probably damaging Het
Rsf1 GGCGGC GGCGGCGGCAGCGGC 7: 97,579,930 probably benign Het
Rsph4a A G 10: 33,914,422 E669G probably damaging Het
Rusc1 A T 3: 89,086,806 V964E probably benign Het
Rusc2 A G 4: 43,415,897 N401S probably damaging Het
Slc10a1 G T 12: 80,956,090 T258K probably damaging Het
Slc5a9 A G 4: 111,890,221 L323P probably damaging Het
Slc6a17 T A 3: 107,471,456 I637F possibly damaging Het
Slc8a2 A G 7: 16,152,855 E641G possibly damaging Het
Ssh2 G T 11: 77,393,150 A77S possibly damaging Het
St13 G T 15: 81,366,386 N316K probably damaging Het
Taf10 A G 7: 105,743,855 M121T probably benign Het
Tcta T C 9: 108,305,743 T68A probably damaging Het
Timd2 A T 11: 46,687,062 Y81N probably damaging Het
Tln2 T C 9: 67,392,487 E161G probably damaging Het
Tmed10 T C 12: 85,350,847 I123V probably benign Het
Ttf1 T C 2: 29,079,480 probably null Het
Tubg1 A G 11: 101,126,060 D396G probably damaging Het
Uhmk1 A G 1: 170,207,344 probably null Het
Unc13a C T 8: 71,650,577 A922T probably benign Het
Usp24 T A 4: 106,362,182 V525E probably damaging Het
Usp28 C A 9: 49,035,737 Q823K probably damaging Het
Vldlr A T 19: 27,246,631 I764F probably benign Het
Vmn2r88 T C 14: 51,411,184 Y62H Het
Zfp423 T A 8: 87,781,097 N873I possibly damaging Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4724705 missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4725938 missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4745972 nonsense probably null
IGL01373:Sptbn2 APN 19 4745972 nonsense probably null
IGL01420:Sptbn2 APN 19 4734125 missense probably benign
IGL01456:Sptbn2 APN 19 4746749 missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4749693 missense probably benign
IGL03026:Sptbn2 APN 19 4724233 critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4732661 missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4747832 missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4745577 missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0121:Sptbn2 UTSW 19 4745293 missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4724744 missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4746942 critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4745145 missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4737926 missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4745938 missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4726690 missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4739986 missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4748123 nonsense probably null
R0742:Sptbn2 UTSW 19 4718983 missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4732665 missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4718976 missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4744246 missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4750242 critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4750497 missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4745964 nonsense probably null
R1820:Sptbn2 UTSW 19 4726596 missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4732541 missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4732685 missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4745299 missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4738559 missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4734138 missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4718935 missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4748636 missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4745922 missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4738355 missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4732602 missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4739239 missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4732496 missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4742480 missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4748154 missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4729430 missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4738469 missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4729309 missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4729202 splice site probably null
R4981:Sptbn2 UTSW 19 4751658 missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4737857 missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4724184 missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4750082 missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4718908 missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4750105 missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4725950 missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4748947 missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4724667 missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4738219 missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4739278 missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4731392 critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4748138 missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4724646 missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4732496 missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4742418 missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4744180 missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4747926 missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4749814 missense probably benign
R6703:Sptbn2 UTSW 19 4749815 missense probably benign
R6753:Sptbn2 UTSW 19 4747785 missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4744145 missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4749460 missense probably null
R7219:Sptbn2 UTSW 19 4724173 missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4737443 missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4751574 missense probably benign
R7469:Sptbn2 UTSW 19 4745118 missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4748082 missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4726168 missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4744207 missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4724125 missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4734143 missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4744262 missense possibly damaging 0.93
R7920:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7921:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7923:Sptbn2 UTSW 19 4746799 missense probably benign 0.01
R8137:Sptbn2 UTSW 19 4737403 missense possibly damaging 0.81
R8305:Sptbn2 UTSW 19 4729130 missense possibly damaging 0.81
R8695:Sptbn2 UTSW 19 4746696 missense possibly damaging 0.86
R8790:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R9125:Sptbn2 UTSW 19 4734213 missense probably benign 0.04
R9620:Sptbn2 UTSW 19 4750507 missense probably damaging 0.99
R9631:Sptbn2 UTSW 19 4738190 missense probably damaging 1.00
R9646:Sptbn2 UTSW 19 4745313 missense probably damaging 1.00
R9694:Sptbn2 UTSW 19 4750507 missense probably damaging 0.99
V7580:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4738205 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4745191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACACAAAGCCTTTCGTGG -3'
(R):5'- AACTACCCATTTGGCAATGTGAG -3'

Sequencing Primer
(F):5'- GGAGTCTTCTGCATCTCCTGG -3'
(R):5'- AGCCTCTGGAAAGAGCATGTCC -3'
Posted On 2022-07-18