Incidental Mutation 'R9483:Sptbn2'
ID 716405
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Name spectrin beta, non-erythrocytic 2
Synonyms Spnb3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9483 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 4761195-4802388 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 4789974 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 1321 (A1321S)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]
AlphaFold Q68FG2
Predicted Effect probably damaging
Transcript: ENSMUST00000008991
AA Change: A1321S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: A1321S

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,339,010 (GRCm39) M334K probably benign Het
Abca1 A T 4: 53,060,351 (GRCm39) I1525N probably benign Het
Abca4 A T 3: 121,879,275 (GRCm39) I398F Het
Acbd3 A G 1: 180,572,721 (GRCm39) D327G probably benign Het
Acsm3 A G 7: 119,383,166 (GRCm39) T544A probably damaging Het
Atp11a C T 8: 12,901,087 (GRCm39) T972M probably damaging Het
Cbfb C T 8: 105,929,123 (GRCm39) R147* probably null Het
Ccdc17 G T 4: 116,454,144 (GRCm39) R54L probably benign Het
Cracdl T G 1: 37,670,496 (GRCm39) E148A probably damaging Het
Cuedc2 G T 19: 46,319,399 (GRCm39) A223E probably benign Het
Cul5 T C 9: 53,532,474 (GRCm39) I787V probably benign Het
D430041D05Rik T A 2: 104,087,563 (GRCm39) H471L probably benign Het
Ddx39a T C 8: 84,448,916 (GRCm39) Y264H probably benign Het
Dlgap3 C A 4: 127,127,665 (GRCm39) R778S probably damaging Het
Esrrg T C 1: 187,930,848 (GRCm39) V313A probably damaging Het
Fam124a T C 14: 62,844,100 (GRCm39) I536T probably damaging Het
Fbxo21 T C 5: 118,127,272 (GRCm39) F275L possibly damaging Het
Gabrg1 C A 5: 70,999,558 (GRCm39) G2V possibly damaging Het
Gcc1 G T 6: 28,418,089 (GRCm39) A748D probably damaging Het
Gjb6 T C 14: 57,361,511 (GRCm39) D250G probably benign Het
Gm44501 A T 17: 40,889,872 (GRCm39) K129* probably null Het
Hmcn2 T G 2: 31,320,375 (GRCm39) L3952R Het
Hpd A G 5: 123,312,535 (GRCm39) I278T probably damaging Het
Igsf3 T A 3: 101,346,904 (GRCm39) F613Y probably damaging Het
Igsf3 T C 3: 101,346,817 (GRCm39) F584S probably damaging Het
Ik A G 18: 36,886,635 (GRCm39) D369G probably benign Het
Ikbke A G 1: 131,198,719 (GRCm39) L365P probably damaging Het
Il22ra2 A T 10: 19,508,542 (GRCm39) Q190L possibly damaging Het
Itga6 T C 2: 71,679,834 (GRCm39) V1033A probably benign Het
Kif18a T C 2: 109,120,032 (GRCm39) Y112H probably damaging Het
Krt75 T C 15: 101,482,238 (GRCm39) H10R probably benign Het
L3mbtl1 T A 2: 162,790,734 (GRCm39) L93H probably benign Het
Lrfn1 G A 7: 28,158,183 (GRCm39) C34Y probably damaging Het
Lrrc47 A T 4: 154,101,920 (GRCm39) I396F probably damaging Het
Mgat3 T A 15: 80,095,641 (GRCm39) V156E probably benign Het
Mtus2 A G 5: 148,232,300 (GRCm39) D1120G possibly damaging Het
Muc5ac G T 7: 141,365,465 (GRCm39) E2700* probably null Het
Nxpe5 A T 5: 138,228,591 (GRCm39) probably benign Het
Or51v15-ps1 T C 7: 103,278,931 (GRCm39) T79A probably damaging Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Pcdhga4 T A 18: 37,819,746 (GRCm39) S432T possibly damaging Het
Pdk4 T A 6: 5,486,716 (GRCm39) M353L probably benign Het
Ppp1r13b T A 12: 111,800,210 (GRCm39) K645N probably benign Het
Ppt1 A T 4: 122,751,367 (GRCm39) D288V possibly damaging Het
Prkcb A G 7: 122,181,663 (GRCm39) Y417C probably damaging Het
Prss22 A G 17: 24,215,721 (GRCm39) I67T probably damaging Het
Rab29 T C 1: 131,795,508 (GRCm39) V40A possibly damaging Het
Rae1 T C 2: 172,849,941 (GRCm39) probably null Het
Rasa3 C T 8: 13,630,033 (GRCm39) probably null Het
Rasgrp3 A G 17: 75,807,717 (GRCm39) D258G probably benign Het
Rcc1 T A 4: 132,062,808 (GRCm39) T208S probably benign Het
Rgs3 C A 4: 62,575,354 (GRCm39) Y580* probably null Het
Rpe65 C T 3: 159,328,318 (GRCm39) P405S probably damaging Het
Rsf1 GGCGGC GGCGGCGGCAGCGGC 7: 97,229,137 (GRCm39) probably benign Het
Rsph4a A G 10: 33,790,418 (GRCm39) E669G probably damaging Het
Rusc1 A T 3: 88,994,113 (GRCm39) V964E probably benign Het
Rusc2 A G 4: 43,415,897 (GRCm39) N401S probably damaging Het
Slc10a1 G T 12: 81,002,864 (GRCm39) T258K probably damaging Het
Slc5a9 A G 4: 111,747,418 (GRCm39) L323P probably damaging Het
Slc6a17 T A 3: 107,378,772 (GRCm39) I637F possibly damaging Het
Slc8a2 A G 7: 15,886,780 (GRCm39) E641G possibly damaging Het
Ssh2 G T 11: 77,283,976 (GRCm39) A77S possibly damaging Het
St13 G T 15: 81,250,587 (GRCm39) N316K probably damaging Het
Taf10 A G 7: 105,393,062 (GRCm39) M121T probably benign Het
Tcta T C 9: 108,182,942 (GRCm39) T68A probably damaging Het
Timd2 A T 11: 46,577,889 (GRCm39) Y81N probably damaging Het
Tln2 T C 9: 67,299,769 (GRCm39) E161G probably damaging Het
Tmed10 T C 12: 85,397,621 (GRCm39) I123V probably benign Het
Ttf1 T C 2: 28,969,492 (GRCm39) probably null Het
Tubg1 A G 11: 101,016,886 (GRCm39) D396G probably damaging Het
Uhmk1 A G 1: 170,034,913 (GRCm39) probably null Het
Unc13a C T 8: 72,103,221 (GRCm39) A922T probably benign Het
Usp24 T A 4: 106,219,379 (GRCm39) V525E probably damaging Het
Usp28 C A 9: 48,947,037 (GRCm39) Q823K probably damaging Het
Vldlr A T 19: 27,224,031 (GRCm39) I764F probably benign Het
Vmn2r88 T C 14: 51,648,641 (GRCm39) Y62H Het
Zfp423 T A 8: 88,507,725 (GRCm39) N873I possibly damaging Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4,774,733 (GRCm39) missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4,775,966 (GRCm39) missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4,796,000 (GRCm39) nonsense probably null
IGL01373:Sptbn2 APN 19 4,796,000 (GRCm39) nonsense probably null
IGL01420:Sptbn2 APN 19 4,784,153 (GRCm39) missense probably benign
IGL01456:Sptbn2 APN 19 4,796,777 (GRCm39) missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4,799,721 (GRCm39) missense probably benign
IGL03026:Sptbn2 APN 19 4,774,261 (GRCm39) critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4,782,689 (GRCm39) missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4,797,860 (GRCm39) missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4,800,660 (GRCm39) missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4,795,605 (GRCm39) missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4,795,405 (GRCm39) intron probably benign
R0046:Sptbn2 UTSW 19 4,795,405 (GRCm39) intron probably benign
R0121:Sptbn2 UTSW 19 4,795,321 (GRCm39) missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4,774,772 (GRCm39) missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4,796,970 (GRCm39) critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4,795,173 (GRCm39) missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4,787,954 (GRCm39) missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4,795,966 (GRCm39) missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4,776,718 (GRCm39) missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4,790,014 (GRCm39) missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4,798,151 (GRCm39) nonsense probably null
R0742:Sptbn2 UTSW 19 4,769,011 (GRCm39) missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4,795,921 (GRCm39) missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4,795,921 (GRCm39) missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4,795,921 (GRCm39) missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4,782,693 (GRCm39) missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4,769,004 (GRCm39) missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4,794,274 (GRCm39) missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4,800,270 (GRCm39) critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4,800,525 (GRCm39) missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4,795,992 (GRCm39) nonsense probably null
R1820:Sptbn2 UTSW 19 4,776,624 (GRCm39) missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4,782,569 (GRCm39) missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4,782,713 (GRCm39) missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4,795,327 (GRCm39) missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4,788,587 (GRCm39) missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4,784,166 (GRCm39) missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4,768,963 (GRCm39) missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4,798,664 (GRCm39) missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4,795,950 (GRCm39) missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4,788,383 (GRCm39) missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4,782,630 (GRCm39) missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4,789,267 (GRCm39) missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4,782,524 (GRCm39) missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4,792,508 (GRCm39) missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4,798,182 (GRCm39) missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4,779,458 (GRCm39) missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4,788,497 (GRCm39) missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4,779,337 (GRCm39) missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4,779,230 (GRCm39) splice site probably null
R4981:Sptbn2 UTSW 19 4,801,686 (GRCm39) missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4,787,885 (GRCm39) missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4,774,212 (GRCm39) missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4,800,110 (GRCm39) missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4,768,936 (GRCm39) missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4,800,133 (GRCm39) missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4,775,978 (GRCm39) missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4,798,975 (GRCm39) missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4,774,695 (GRCm39) missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4,788,247 (GRCm39) missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4,789,306 (GRCm39) missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4,781,420 (GRCm39) critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4,798,166 (GRCm39) missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4,774,674 (GRCm39) missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4,782,524 (GRCm39) missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4,792,446 (GRCm39) missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4,794,208 (GRCm39) missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4,797,954 (GRCm39) missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4,782,052 (GRCm39) missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4,799,843 (GRCm39) missense probably benign
R6703:Sptbn2 UTSW 19 4,799,842 (GRCm39) missense probably benign
R6753:Sptbn2 UTSW 19 4,797,813 (GRCm39) missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4,794,173 (GRCm39) missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4,799,488 (GRCm39) missense probably null
R7219:Sptbn2 UTSW 19 4,774,201 (GRCm39) missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4,787,471 (GRCm39) missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4,801,602 (GRCm39) missense probably benign
R7469:Sptbn2 UTSW 19 4,795,146 (GRCm39) missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4,798,110 (GRCm39) missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4,776,196 (GRCm39) missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4,794,235 (GRCm39) missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4,774,153 (GRCm39) missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4,784,171 (GRCm39) missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4,794,290 (GRCm39) missense possibly damaging 0.93
R7920:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7921:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7923:Sptbn2 UTSW 19 4,796,827 (GRCm39) missense probably benign 0.01
R8137:Sptbn2 UTSW 19 4,787,431 (GRCm39) missense possibly damaging 0.81
R8305:Sptbn2 UTSW 19 4,779,158 (GRCm39) missense possibly damaging 0.81
R8695:Sptbn2 UTSW 19 4,796,724 (GRCm39) missense possibly damaging 0.86
R8790:Sptbn2 UTSW 19 4,782,052 (GRCm39) missense probably damaging 1.00
R9125:Sptbn2 UTSW 19 4,784,241 (GRCm39) missense probably benign 0.04
R9620:Sptbn2 UTSW 19 4,800,535 (GRCm39) missense probably damaging 0.99
R9631:Sptbn2 UTSW 19 4,788,218 (GRCm39) missense probably damaging 1.00
R9646:Sptbn2 UTSW 19 4,795,341 (GRCm39) missense probably damaging 1.00
R9694:Sptbn2 UTSW 19 4,800,535 (GRCm39) missense probably damaging 0.99
V7580:Sptbn2 UTSW 19 4,800,660 (GRCm39) missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4,795,219 (GRCm39) missense probably benign 0.01
Z1176:Sptbn2 UTSW 19 4,788,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACAAAGCCTTTCGTGG -3'
(R):5'- AACTACCCATTTGGCAATGTGAG -3'

Sequencing Primer
(F):5'- GGAGTCTTCTGCATCTCCTGG -3'
(R):5'- AGCCTCTGGAAAGAGCATGTCC -3'
Posted On 2022-07-18