Incidental Mutation 'R9484:Kcnk2'
ID 716412
Institutional Source Beutler Lab
Gene Symbol Kcnk2
Ensembl Gene ENSMUSG00000037624
Gene Name potassium channel, subfamily K, member 2
Synonyms TREK-1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R9484 (G1)
Quality Score 135.467
Status Not validated
Chromosome 1
Chromosomal Location 188940127-189134470 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CAAA to CAA at 188988891 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079451] [ENSMUST00000110920] [ENSMUST00000180044] [ENSMUST00000192723] [ENSMUST00000193319] [ENSMUST00000194172] [ENSMUST00000194402]
AlphaFold P97438
Predicted Effect probably null
Transcript: ENSMUST00000079451
SMART Domains Protein: ENSMUSP00000078416
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 117 197 2e-20 PFAM
low complexity region 221 230 N/A INTRINSIC
Pfam:Ion_trans_2 233 313 6.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110920
SMART Domains Protein: ENSMUSP00000106545
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180044
SMART Domains Protein: ENSMUSP00000136513
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000192723
SMART Domains Protein: ENSMUSP00000141849
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000193319
SMART Domains Protein: ENSMUSP00000141891
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 117 198 2.5e-21 PFAM
Pfam:Ion_trans_2 226 313 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194172
SMART Domains Protein: ENSMUSP00000142176
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
Pfam:Ion_trans_2 113 194 5e-20 PFAM
low complexity region 216 231 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000194402
SMART Domains Protein: ENSMUSP00000142026
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
Pfam:Ion_trans_2 113 194 1.4e-19 PFAM
Pfam:Ion_trans_2 222 309 2.2e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the two-pore-domain background potassium channel protein family. This type of potassium channel is formed by two homodimers that create a channel that leaks potassium out of the cell to control resting membrane potential. The channel can be opened, however, by certain anesthetics, membrane stretching, intracellular acidosis, and heat. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased sensitivity to pharmacologically induced seizures and ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,250,845 (GRCm39) C151S probably damaging Het
Actr8 T C 14: 29,708,301 (GRCm39) I193T probably benign Het
Btbd2 T C 10: 80,480,103 (GRCm39) N419S probably benign Het
Cacna2d1 T A 5: 16,561,831 (GRCm39) W821R probably damaging Het
Cadps2 T C 6: 23,626,646 (GRCm39) Y214C probably benign Het
Calu T A 6: 29,366,162 (GRCm39) L180Q probably damaging Het
Corin C T 5: 72,497,280 (GRCm39) V615I probably damaging Het
Cyp8b1 A T 9: 121,744,983 (GRCm39) D116E probably benign Het
D630036H23Rik C A 12: 36,431,711 (GRCm39) A96S unknown Het
Ddx24 A T 12: 103,377,555 (GRCm39) Y717N probably damaging Het
Dmap1 G T 4: 117,533,308 (GRCm39) Q249K probably benign Het
Dnah10 T A 5: 124,900,508 (GRCm39) W3922R probably damaging Het
Dnah14 T C 1: 181,517,773 (GRCm39) F2036L probably benign Het
Dnah14 T C 1: 181,625,311 (GRCm39) I4064T probably benign Het
Dock9 A C 14: 121,818,844 (GRCm39) V1546G probably damaging Het
Eif1ad4 A T 12: 87,862,249 (GRCm39) Q37L possibly damaging Het
Eif3a A T 19: 60,755,006 (GRCm39) S1059T unknown Het
Ep300 A G 15: 81,521,026 (GRCm39) E1262G unknown Het
Evl T A 12: 108,652,716 (GRCm39) I387N probably damaging Het
Fat2 A C 11: 55,200,752 (GRCm39) V774G probably damaging Het
Fez1 T A 9: 36,755,093 (GRCm39) Y31N probably benign Het
Fkbp10 A G 11: 100,313,960 (GRCm39) I435V probably damaging Het
Flnb A G 14: 7,929,004 (GRCm38) D1911G probably benign Het
Fnbp1 T C 2: 30,973,038 (GRCm39) Y154C probably benign Het
Fndc10 T C 4: 155,779,496 (GRCm39) I180T possibly damaging Het
Frmd4a G A 2: 4,609,026 (GRCm39) V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 (GRCm39) H64R possibly damaging Het
Glis3 T C 19: 28,508,403 (GRCm39) D527G probably damaging Het
H2-Ob T A 17: 34,459,989 (GRCm39) F33L probably damaging Het
Hbb-bh1 C T 7: 103,492,239 (GRCm39) E27K probably benign Het
Ifnb1 T A 4: 88,440,915 (GRCm39) T33S probably benign Het
Igkv4-80 T A 6: 68,993,766 (GRCm39) T42S probably damaging Het
Irs2 C T 8: 11,057,334 (GRCm39) G366D probably damaging Het
Krtap5-3 T A 7: 141,756,068 (GRCm39) C302S unknown Het
Lgi1 A G 19: 38,294,757 (GRCm39) K510E probably benign Het
Lgi2 T A 5: 52,695,936 (GRCm39) D341V probably benign Het
Lin7c T C 2: 109,724,813 (GRCm39) I14T probably benign Het
Lrrc19 A T 4: 94,531,573 (GRCm39) M13K probably benign Het
Lrrc69 T C 4: 14,666,012 (GRCm39) I315M probably benign Het
Mtcl3 G A 10: 29,072,969 (GRCm39) D754N probably damaging Het
Myo5c A T 9: 75,204,770 (GRCm39) D1541V probably damaging Het
Mypn T G 10: 63,003,019 (GRCm39) M373L probably benign Het
Nckipsd C A 9: 108,689,837 (GRCm39) H333N probably damaging Het
Nrg2 A T 18: 36,157,401 (GRCm39) L428Q probably null Het
Or13a20 T C 7: 140,231,904 (GRCm39) L4S probably benign Het
Or2b28 C A 13: 21,531,587 (GRCm39) T163K probably damaging Het
Or5an11 T C 19: 12,245,735 (GRCm39) I47T possibly damaging Het
Otogl T A 10: 107,657,894 (GRCm39) probably null Het
Otogl C T 10: 107,737,156 (GRCm39) G86D probably damaging Het
Papln A T 12: 83,838,618 (GRCm39) Q1249L probably benign Het
Plxna2 G T 1: 194,327,202 (GRCm39) G379C probably damaging Het
Pofut2 T C 10: 77,095,260 (GRCm39) I35T probably benign Het
Pros1 A G 16: 62,744,887 (GRCm39) T501A possibly damaging Het
Rapgef1 T C 2: 29,625,821 (GRCm39) S1042P possibly damaging Het
Rps6kb1 C T 11: 86,408,443 (GRCm39) E185K probably damaging Het
Slc13a2 A T 11: 78,294,233 (GRCm39) L216Q probably damaging Het
Slc22a14 T C 9: 119,009,615 (GRCm39) Y160C probably damaging Het
Slc22a4 T A 11: 53,879,773 (GRCm39) I429F possibly damaging Het
Slc26a3 A G 12: 31,511,785 (GRCm39) K457E probably damaging Het
Slc47a2 T C 11: 61,227,060 (GRCm39) I169M possibly damaging Het
Slco1a1 C T 6: 141,854,672 (GRCm39) V660I probably benign Het
Smyd1 A G 6: 71,202,450 (GRCm39) Y252H probably damaging Het
Spp2 A T 1: 88,334,695 (GRCm39) probably benign Het
Stra8 T A 6: 34,911,121 (GRCm39) W250R probably damaging Het
Syne1 A C 10: 5,170,359 (GRCm39) L5183R probably damaging Het
Tdrd9 T C 12: 112,012,684 (GRCm39) S1203P probably damaging Het
Th C A 7: 142,453,620 (GRCm39) E27* probably null Het
Thada C A 17: 84,736,619 (GRCm39) L887F probably damaging Het
Timm23 T C 14: 31,902,586 (GRCm39) T186A probably benign Het
Tmem132b A T 5: 125,860,420 (GRCm39) E555V probably damaging Het
Tnik A T 3: 28,649,093 (GRCm39) Q457L unknown Het
Uba7 C A 9: 107,861,037 (GRCm39) H942Q probably benign Het
Upf2 T C 2: 5,966,078 (GRCm39) S233P unknown Het
Urm1 T A 2: 29,732,760 (GRCm39) N72K probably damaging Het
Usp10 T C 8: 120,675,504 (GRCm39) S508P possibly damaging Het
Usp37 G A 1: 74,499,081 (GRCm39) P632S probably damaging Het
Wdr77 T A 3: 105,872,404 (GRCm39) N209K probably benign Het
Zbtb24 C T 10: 41,327,429 (GRCm39) T105M probably benign Het
Zfp341 T A 2: 154,485,763 (GRCm39) I671N probably damaging Het
Zfp414 A G 17: 33,848,984 (GRCm39) T73A probably benign Het
Zfp574 A T 7: 24,781,404 (GRCm39) I809F possibly damaging Het
Zfp62 T C 11: 49,108,108 (GRCm39) I733T probably damaging Het
Zfp719 A G 7: 43,239,581 (GRCm39) I390V possibly damaging Het
Other mutations in Kcnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Kcnk2 APN 1 188,975,211 (GRCm39) missense probably damaging 0.96
IGL01100:Kcnk2 APN 1 189,072,133 (GRCm39) missense probably damaging 1.00
IGL01872:Kcnk2 APN 1 188,988,780 (GRCm39) missense probably damaging 1.00
IGL01929:Kcnk2 APN 1 189,072,227 (GRCm39) missense probably damaging 1.00
IGL02643:Kcnk2 APN 1 188,990,976 (GRCm39) missense possibly damaging 0.63
IGL03056:Kcnk2 APN 1 189,027,908 (GRCm39) missense possibly damaging 0.82
IGL03340:Kcnk2 APN 1 189,027,878 (GRCm39) missense possibly damaging 0.51
R0041:Kcnk2 UTSW 1 189,027,888 (GRCm39) missense probably benign 0.44
R0041:Kcnk2 UTSW 1 189,027,888 (GRCm39) missense probably benign 0.44
R0279:Kcnk2 UTSW 1 188,942,169 (GRCm39) missense possibly damaging 0.58
R0569:Kcnk2 UTSW 1 189,071,998 (GRCm39) missense probably damaging 1.00
R0645:Kcnk2 UTSW 1 188,988,927 (GRCm39) splice site probably null
R1070:Kcnk2 UTSW 1 188,988,960 (GRCm39) splice site probably benign
R1449:Kcnk2 UTSW 1 189,072,223 (GRCm39) missense probably benign 0.31
R2401:Kcnk2 UTSW 1 189,072,214 (GRCm39) missense possibly damaging 0.64
R4418:Kcnk2 UTSW 1 188,988,924 (GRCm39) missense probably damaging 1.00
R4923:Kcnk2 UTSW 1 189,072,133 (GRCm39) missense probably damaging 1.00
R5782:Kcnk2 UTSW 1 188,988,776 (GRCm39) missense probably damaging 1.00
R5845:Kcnk2 UTSW 1 189,009,918 (GRCm39) intron probably benign
R6140:Kcnk2 UTSW 1 188,942,104 (GRCm39) missense probably damaging 0.97
R6240:Kcnk2 UTSW 1 188,975,179 (GRCm39) missense probably damaging 1.00
R6881:Kcnk2 UTSW 1 188,942,187 (GRCm39) missense probably benign 0.00
R7990:Kcnk2 UTSW 1 188,942,102 (GRCm39) missense probably damaging 0.99
R8046:Kcnk2 UTSW 1 188,990,933 (GRCm39) critical splice donor site probably null
R8322:Kcnk2 UTSW 1 189,072,046 (GRCm39) missense probably benign 0.00
R9099:Kcnk2 UTSW 1 188,991,072 (GRCm39) missense probably damaging 1.00
R9482:Kcnk2 UTSW 1 188,988,891 (GRCm39) frame shift probably null
R9576:Kcnk2 UTSW 1 188,988,891 (GRCm39) frame shift probably null
R9577:Kcnk2 UTSW 1 188,988,891 (GRCm39) frame shift probably null
R9578:Kcnk2 UTSW 1 188,988,891 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGAGTCTTTGGCATAGCAGC -3'
(R):5'- AACCGGATGAGCAAATGCAC -3'

Sequencing Primer
(F):5'- GAGCCTGTGTTCCGTTATAAACCAG -3'
(R):5'- TGAAGAAAACATTTTACCCGTGGG -3'
Posted On 2022-07-18