Incidental Mutation 'R9484:Fnbp1'
ID 716418
Institutional Source Beutler Lab
Gene Symbol Fnbp1
Ensembl Gene ENSMUSG00000075415
Gene Name formin binding protein 1
Synonyms 2210010H06Rik, FBP17, FBP1, 1110057E06Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.557) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 31026206-31142008 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31083026 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 154 (Y154C)
Ref Sequence ENSEMBL: ENSMUSP00000109190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073879] [ENSMUST00000075326] [ENSMUST00000100207] [ENSMUST00000100208] [ENSMUST00000113552] [ENSMUST00000113555] [ENSMUST00000113559] [ENSMUST00000113560] [ENSMUST00000113562] [ENSMUST00000113564] [ENSMUST00000136181] [ENSMUST00000149196]
AlphaFold Q80TY0
Predicted Effect probably benign
Transcript: ENSMUST00000073879
AA Change: Y154C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109188
Gene: ENSMUSG00000075415
AA Change: Y154C

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075326
AA Change: Y154C

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000074796
Gene: ENSMUSG00000075415
AA Change: Y154C

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 360 451 1e-26 PDB
low complexity region 503 512 N/A INTRINSIC
SH3 518 575 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100207
AA Change: Y154C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000097781
Gene: ENSMUSG00000075415
AA Change: Y154C

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 338 424 1e-26 PDB
low complexity region 476 485 N/A INTRINSIC
SH3 491 548 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100208
AA Change: Y154C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097782
Gene: ENSMUSG00000075415
AA Change: Y154C

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 394 480 2e-26 PDB
low complexity region 532 541 N/A INTRINSIC
SH3 547 604 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113552
AA Change: Y154C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109181
Gene: ENSMUSG00000075415
AA Change: Y154C

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113555
AA Change: Y154C

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109184
Gene: ENSMUSG00000075415
AA Change: Y154C

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 370 456 1e-26 PDB
low complexity region 508 517 N/A INTRINSIC
SH3 523 580 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113559
AA Change: Y75C

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109189
Gene: ENSMUSG00000075415
AA Change: Y75C

DomainStartEndE-ValueType
PDB:2EFL|A 1 221 1e-144 PDB
low complexity region 250 262 N/A INTRINSIC
PDB:2KE4|A 300 391 1e-26 PDB
low complexity region 443 452 N/A INTRINSIC
SH3 458 515 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113560
AA Change: Y154C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109190
Gene: ENSMUSG00000075415
AA Change: Y154C

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 399 485 2e-26 PDB
low complexity region 537 546 N/A INTRINSIC
SH3 552 609 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113562
AA Change: Y154C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109192
Gene: ENSMUSG00000075415
AA Change: Y154C

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113564
AA Change: Y154C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109194
Gene: ENSMUSG00000075415
AA Change: Y154C

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 472 481 N/A INTRINSIC
SH3 487 544 3.2e-15 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000115013
Gene: ENSMUSG00000075415
AA Change: Y144C

DomainStartEndE-ValueType
Pfam:FCH 1 80 7.7e-20 PFAM
PDB:2KE4|A 167 253 2e-27 PDB
low complexity region 305 314 N/A INTRINSIC
SH3 320 377 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136181
SMART Domains Protein: ENSMUSP00000120580
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 116 125 N/A INTRINSIC
PDB:2EFL|A 126 160 1e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000149196
AA Change: Y167C

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000121282
Gene: ENSMUSG00000075415
AA Change: Y167C

DomainStartEndE-ValueType
FCH 14 107 8.88e-17 SMART
low complexity region 185 194 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the formin-binding-protein family. The protein contains an N-terminal Fer/Cdc42-interacting protein 4 (CIP4) homology (FCH) domain followed by a coiled-coil domain, a proline-rich motif, a second coiled-coil domain, a Rho family protein-binding domain (RBD), and a C-terminal SH3 domain. This protein binds sorting nexin 2 (SNX2), tankyrase (TNKS), and dynamin; an interaction between this protein and formin has not been demonstrated yet in human. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,112,786 (GRCm38) C151S probably damaging Het
Actr8 T C 14: 29,986,344 (GRCm38) I193T probably benign Het
Btbd2 T C 10: 80,644,269 (GRCm38) N419S probably benign Het
Cacna2d1 T A 5: 16,356,833 (GRCm38) W821R probably damaging Het
Cadps2 T C 6: 23,626,647 (GRCm38) Y214C probably benign Het
Calu T A 6: 29,366,163 (GRCm38) L180Q probably damaging Het
Corin C T 5: 72,339,937 (GRCm38) V615I probably damaging Het
Cyp8b1 A T 9: 121,915,917 (GRCm38) D116E probably benign Het
D630036H23Rik C A 12: 36,381,712 (GRCm38) A96S unknown Het
Ddx24 A T 12: 103,411,296 (GRCm38) Y717N probably damaging Het
Dmap1 G T 4: 117,676,111 (GRCm38) Q249K probably benign Het
Dnah10 T A 5: 124,823,444 (GRCm38) W3922R probably damaging Het
Dnah14 T C 1: 181,690,208 (GRCm38) F2036L probably benign Het
Dnah14 T C 1: 181,797,746 (GRCm38) I4064T probably benign Het
Dock9 A C 14: 121,581,432 (GRCm38) V1546G probably damaging Het
Eif1ad4 A T 12: 87,895,479 (GRCm38) Q37L possibly damaging Het
Eif3a A T 19: 60,766,568 (GRCm38) S1059T unknown Het
Ep300 A G 15: 81,636,825 (GRCm38) E1262G unknown Het
Evl T A 12: 108,686,457 (GRCm38) I387N probably damaging Het
Fat2 A C 11: 55,309,926 (GRCm38) V774G probably damaging Het
Fez1 T A 9: 36,843,797 (GRCm38) Y31N probably benign Het
Fkbp10 A G 11: 100,423,134 (GRCm38) I435V probably damaging Het
Flnb A G 14: 7,929,004 (GRCm38) D1911G probably benign Het
Fndc10 T C 4: 155,695,039 (GRCm38) I180T possibly damaging Het
Frmd4a G A 2: 4,604,215 (GRCm38) V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 (GRCm38) H64R possibly damaging Het
Glis3 T C 19: 28,531,003 (GRCm38) D527G probably damaging Het
H2-Ob T A 17: 34,241,015 (GRCm38) F33L probably damaging Het
Hbb-bh1 C T 7: 103,843,032 (GRCm38) E27K probably benign Het
Ifnb1 T A 4: 88,522,678 (GRCm38) T33S probably benign Het
Igkv4-80 T A 6: 69,016,782 (GRCm38) T42S probably damaging Het
Irs2 C T 8: 11,007,334 (GRCm38) G366D probably damaging Het
Kcnk2 CAAA CAA 1: 189,256,694 (GRCm38) probably null Het
Krtap5-3 T A 7: 142,202,331 (GRCm38) C302S unknown Het
Lgi1 A G 19: 38,306,309 (GRCm38) K510E probably benign Het
Lgi2 T A 5: 52,538,594 (GRCm38) D341V probably benign Het
Lin7c T C 2: 109,894,468 (GRCm38) I14T probably benign Het
Lrrc19 A T 4: 94,643,336 (GRCm38) M13K probably benign Het
Lrrc69 T C 4: 14,666,012 (GRCm38) I315M probably benign Het
Mtcl3 G A 10: 29,196,973 (GRCm38) D754N probably damaging Het
Myo5c A T 9: 75,297,488 (GRCm38) D1541V probably damaging Het
Mypn T G 10: 63,167,240 (GRCm38) M373L probably benign Het
Nckipsd C A 9: 108,812,638 (GRCm38) H333N probably damaging Het
Nrg2 A T 18: 36,024,348 (GRCm38) L428Q probably null Het
Or13a20 T C 7: 140,651,991 (GRCm38) L4S probably benign Het
Or2b28 C A 13: 21,347,417 (GRCm38) T163K probably damaging Het
Or5an11 T C 19: 12,268,371 (GRCm38) I47T possibly damaging Het
Otogl T A 10: 107,822,033 (GRCm38) probably null Het
Otogl C T 10: 107,901,295 (GRCm38) G86D probably damaging Het
Papln A T 12: 83,791,844 (GRCm38) Q1249L probably benign Het
Plxna2 G T 1: 194,644,894 (GRCm38) G379C probably damaging Het
Pofut2 T C 10: 77,259,426 (GRCm38) I35T probably benign Het
Pros1 A G 16: 62,924,524 (GRCm38) T501A possibly damaging Het
Rapgef1 T C 2: 29,735,809 (GRCm38) S1042P possibly damaging Het
Rps6kb1 C T 11: 86,517,617 (GRCm38) E185K probably damaging Het
Slc13a2 A T 11: 78,403,407 (GRCm38) L216Q probably damaging Het
Slc22a14 T C 9: 119,180,549 (GRCm38) Y160C probably damaging Het
Slc22a4 T A 11: 53,988,947 (GRCm38) I429F possibly damaging Het
Slc26a3 A G 12: 31,461,786 (GRCm38) K457E probably damaging Het
Slc47a2 T C 11: 61,336,234 (GRCm38) I169M possibly damaging Het
Slco1a1 C T 6: 141,908,946 (GRCm38) V660I probably benign Het
Smyd1 A G 6: 71,225,466 (GRCm38) Y252H probably damaging Het
Spp2 A T 1: 88,406,973 (GRCm38) probably benign Het
Stra8 T A 6: 34,934,186 (GRCm38) W250R probably damaging Het
Syne1 A C 10: 5,220,359 (GRCm38) L5183R probably damaging Het
Tdrd9 T C 12: 112,046,250 (GRCm38) S1203P probably damaging Het
Th C A 7: 142,899,883 (GRCm38) E27* probably null Het
Thada C A 17: 84,429,191 (GRCm38) L887F probably damaging Het
Timm23 T C 14: 32,180,629 (GRCm38) T186A probably benign Het
Tmem132b A T 5: 125,783,356 (GRCm38) E555V probably damaging Het
Tnik A T 3: 28,594,944 (GRCm38) Q457L unknown Het
Uba7 C A 9: 107,983,838 (GRCm38) H942Q probably benign Het
Upf2 T C 2: 5,961,267 (GRCm38) S233P unknown Het
Urm1 T A 2: 29,842,748 (GRCm38) N72K probably damaging Het
Usp10 T C 8: 119,948,765 (GRCm38) S508P possibly damaging Het
Usp37 G A 1: 74,459,922 (GRCm38) P632S probably damaging Het
Wdr77 T A 3: 105,965,088 (GRCm38) N209K probably benign Het
Zbtb24 C T 10: 41,451,433 (GRCm38) T105M probably benign Het
Zfp341 T A 2: 154,643,843 (GRCm38) I671N probably damaging Het
Zfp414 A G 17: 33,630,010 (GRCm38) T73A probably benign Het
Zfp574 A T 7: 25,081,979 (GRCm38) I809F possibly damaging Het
Zfp62 T C 11: 49,217,281 (GRCm38) I733T probably damaging Het
Zfp719 A G 7: 43,590,157 (GRCm38) I390V possibly damaging Het
Other mutations in Fnbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Fnbp1 APN 2 31,083,042 (GRCm38) missense probably damaging 1.00
IGL01640:Fnbp1 APN 2 31,105,291 (GRCm38) missense probably damaging 1.00
R0381:Fnbp1 UTSW 2 31,033,029 (GRCm38) missense probably benign 0.02
R0573:Fnbp1 UTSW 2 31,058,978 (GRCm38) missense probably damaging 1.00
R0713:Fnbp1 UTSW 2 31,036,594 (GRCm38) missense probably damaging 0.97
R1120:Fnbp1 UTSW 2 31,036,594 (GRCm38) missense probably damaging 0.97
R1364:Fnbp1 UTSW 2 31,059,031 (GRCm38) splice site probably benign
R1974:Fnbp1 UTSW 2 31,053,047 (GRCm38) missense probably null 0.94
R3800:Fnbp1 UTSW 2 31,033,131 (GRCm38) missense probably damaging 1.00
R4176:Fnbp1 UTSW 2 31,036,119 (GRCm38) splice site probably null
R4293:Fnbp1 UTSW 2 31,105,350 (GRCm38) missense probably damaging 1.00
R4478:Fnbp1 UTSW 2 31,105,254 (GRCm38) missense probably damaging 1.00
R4602:Fnbp1 UTSW 2 31,036,540 (GRCm38) critical splice donor site probably null
R4716:Fnbp1 UTSW 2 31,055,520 (GRCm38) missense probably benign 0.03
R5909:Fnbp1 UTSW 2 31,048,199 (GRCm38) splice site probably null
R6436:Fnbp1 UTSW 2 31,096,127 (GRCm38) missense probably damaging 1.00
R7075:Fnbp1 UTSW 2 31,058,914 (GRCm38) missense probably benign
R7747:Fnbp1 UTSW 2 31,036,147 (GRCm38) missense probably damaging 0.99
R8069:Fnbp1 UTSW 2 31,036,594 (GRCm38) missense probably damaging 0.97
R8870:Fnbp1 UTSW 2 31,048,210 (GRCm38) missense
R8945:Fnbp1 UTSW 2 31,105,334 (GRCm38) missense probably damaging 1.00
R9032:Fnbp1 UTSW 2 31,083,005 (GRCm38) missense probably damaging 1.00
R9662:Fnbp1 UTSW 2 31,096,030 (GRCm38) missense probably damaging 0.97
Z1177:Fnbp1 UTSW 2 31,083,059 (GRCm38) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGTGACTAAGCACATGACCTC -3'
(R):5'- CGCAGGTCACTTCTGGAAATG -3'

Sequencing Primer
(F):5'- GTGATGAGATAAAATGAAACCCTTCC -3'
(R):5'- GTCACTTCTGGAAATGACCAAGCATG -3'
Posted On 2022-07-18