Incidental Mutation 'R9484:Corin'
ID 716431
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Name corin, serine peptidase
Synonyms Lrp4
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.267) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 72457368-72661816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72497280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 615 (V615I)
Ref Sequence ENSEMBL: ENSMUSP00000005352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
AlphaFold Q9Z319
Predicted Effect probably damaging
Transcript: ENSMUST00000005352
AA Change: V615I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: V615I

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167460
AA Change: V549I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: V549I

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175766
AA Change: V474I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: V474I

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176974
AA Change: V512I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: V512I

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177290
AA Change: V482I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: V482I

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,250,845 (GRCm39) C151S probably damaging Het
Actr8 T C 14: 29,708,301 (GRCm39) I193T probably benign Het
Btbd2 T C 10: 80,480,103 (GRCm39) N419S probably benign Het
Cacna2d1 T A 5: 16,561,831 (GRCm39) W821R probably damaging Het
Cadps2 T C 6: 23,626,646 (GRCm39) Y214C probably benign Het
Calu T A 6: 29,366,162 (GRCm39) L180Q probably damaging Het
Cyp8b1 A T 9: 121,744,983 (GRCm39) D116E probably benign Het
D630036H23Rik C A 12: 36,431,711 (GRCm39) A96S unknown Het
Ddx24 A T 12: 103,377,555 (GRCm39) Y717N probably damaging Het
Dmap1 G T 4: 117,533,308 (GRCm39) Q249K probably benign Het
Dnah10 T A 5: 124,900,508 (GRCm39) W3922R probably damaging Het
Dnah14 T C 1: 181,517,773 (GRCm39) F2036L probably benign Het
Dnah14 T C 1: 181,625,311 (GRCm39) I4064T probably benign Het
Dock9 A C 14: 121,818,844 (GRCm39) V1546G probably damaging Het
Eif1ad4 A T 12: 87,862,249 (GRCm39) Q37L possibly damaging Het
Eif3a A T 19: 60,755,006 (GRCm39) S1059T unknown Het
Ep300 A G 15: 81,521,026 (GRCm39) E1262G unknown Het
Evl T A 12: 108,652,716 (GRCm39) I387N probably damaging Het
Fat2 A C 11: 55,200,752 (GRCm39) V774G probably damaging Het
Fez1 T A 9: 36,755,093 (GRCm39) Y31N probably benign Het
Fkbp10 A G 11: 100,313,960 (GRCm39) I435V probably damaging Het
Flnb A G 14: 7,929,004 (GRCm38) D1911G probably benign Het
Fnbp1 T C 2: 30,973,038 (GRCm39) Y154C probably benign Het
Fndc10 T C 4: 155,779,496 (GRCm39) I180T possibly damaging Het
Frmd4a G A 2: 4,609,026 (GRCm39) V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 (GRCm39) H64R possibly damaging Het
Glis3 T C 19: 28,508,403 (GRCm39) D527G probably damaging Het
H2-Ob T A 17: 34,459,989 (GRCm39) F33L probably damaging Het
Hbb-bh1 C T 7: 103,492,239 (GRCm39) E27K probably benign Het
Ifnb1 T A 4: 88,440,915 (GRCm39) T33S probably benign Het
Igkv4-80 T A 6: 68,993,766 (GRCm39) T42S probably damaging Het
Irs2 C T 8: 11,057,334 (GRCm39) G366D probably damaging Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,068 (GRCm39) C302S unknown Het
Lgi1 A G 19: 38,294,757 (GRCm39) K510E probably benign Het
Lgi2 T A 5: 52,695,936 (GRCm39) D341V probably benign Het
Lin7c T C 2: 109,724,813 (GRCm39) I14T probably benign Het
Lrrc19 A T 4: 94,531,573 (GRCm39) M13K probably benign Het
Lrrc69 T C 4: 14,666,012 (GRCm39) I315M probably benign Het
Mtcl3 G A 10: 29,072,969 (GRCm39) D754N probably damaging Het
Myo5c A T 9: 75,204,770 (GRCm39) D1541V probably damaging Het
Mypn T G 10: 63,003,019 (GRCm39) M373L probably benign Het
Nckipsd C A 9: 108,689,837 (GRCm39) H333N probably damaging Het
Nrg2 A T 18: 36,157,401 (GRCm39) L428Q probably null Het
Or13a20 T C 7: 140,231,904 (GRCm39) L4S probably benign Het
Or2b28 C A 13: 21,531,587 (GRCm39) T163K probably damaging Het
Or5an11 T C 19: 12,245,735 (GRCm39) I47T possibly damaging Het
Otogl T A 10: 107,657,894 (GRCm39) probably null Het
Otogl C T 10: 107,737,156 (GRCm39) G86D probably damaging Het
Papln A T 12: 83,838,618 (GRCm39) Q1249L probably benign Het
Plxna2 G T 1: 194,327,202 (GRCm39) G379C probably damaging Het
Pofut2 T C 10: 77,095,260 (GRCm39) I35T probably benign Het
Pros1 A G 16: 62,744,887 (GRCm39) T501A possibly damaging Het
Rapgef1 T C 2: 29,625,821 (GRCm39) S1042P possibly damaging Het
Rps6kb1 C T 11: 86,408,443 (GRCm39) E185K probably damaging Het
Slc13a2 A T 11: 78,294,233 (GRCm39) L216Q probably damaging Het
Slc22a14 T C 9: 119,009,615 (GRCm39) Y160C probably damaging Het
Slc22a4 T A 11: 53,879,773 (GRCm39) I429F possibly damaging Het
Slc26a3 A G 12: 31,511,785 (GRCm39) K457E probably damaging Het
Slc47a2 T C 11: 61,227,060 (GRCm39) I169M possibly damaging Het
Slco1a1 C T 6: 141,854,672 (GRCm39) V660I probably benign Het
Smyd1 A G 6: 71,202,450 (GRCm39) Y252H probably damaging Het
Spp2 A T 1: 88,334,695 (GRCm39) probably benign Het
Stra8 T A 6: 34,911,121 (GRCm39) W250R probably damaging Het
Syne1 A C 10: 5,170,359 (GRCm39) L5183R probably damaging Het
Tdrd9 T C 12: 112,012,684 (GRCm39) S1203P probably damaging Het
Th C A 7: 142,453,620 (GRCm39) E27* probably null Het
Thada C A 17: 84,736,619 (GRCm39) L887F probably damaging Het
Timm23 T C 14: 31,902,586 (GRCm39) T186A probably benign Het
Tmem132b A T 5: 125,860,420 (GRCm39) E555V probably damaging Het
Tnik A T 3: 28,649,093 (GRCm39) Q457L unknown Het
Uba7 C A 9: 107,861,037 (GRCm39) H942Q probably benign Het
Upf2 T C 2: 5,966,078 (GRCm39) S233P unknown Het
Urm1 T A 2: 29,732,760 (GRCm39) N72K probably damaging Het
Usp10 T C 8: 120,675,504 (GRCm39) S508P possibly damaging Het
Usp37 G A 1: 74,499,081 (GRCm39) P632S probably damaging Het
Wdr77 T A 3: 105,872,404 (GRCm39) N209K probably benign Het
Zbtb24 C T 10: 41,327,429 (GRCm39) T105M probably benign Het
Zfp341 T A 2: 154,485,763 (GRCm39) I671N probably damaging Het
Zfp414 A G 17: 33,848,984 (GRCm39) T73A probably benign Het
Zfp574 A T 7: 24,781,404 (GRCm39) I809F possibly damaging Het
Zfp62 T C 11: 49,108,108 (GRCm39) I733T probably damaging Het
Zfp719 A G 7: 43,239,581 (GRCm39) I390V possibly damaging Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72,462,231 (GRCm39) missense probably damaging 1.00
IGL01114:Corin APN 5 72,462,354 (GRCm39) missense probably damaging 1.00
IGL01351:Corin APN 5 72,496,334 (GRCm39) missense probably damaging 1.00
IGL01516:Corin APN 5 72,611,830 (GRCm39) nonsense probably null
IGL01785:Corin APN 5 72,497,219 (GRCm39) missense probably damaging 1.00
IGL01786:Corin APN 5 72,497,219 (GRCm39) missense probably damaging 1.00
IGL01845:Corin APN 5 72,511,282 (GRCm39) missense probably damaging 1.00
IGL02097:Corin APN 5 72,529,489 (GRCm39) missense probably damaging 1.00
IGL02629:Corin APN 5 72,490,016 (GRCm39) missense probably damaging 1.00
IGL03085:Corin APN 5 72,511,273 (GRCm39) missense probably damaging 1.00
IGL03120:Corin APN 5 72,518,032 (GRCm39) missense probably damaging 1.00
IGL03150:Corin APN 5 72,460,201 (GRCm39) missense probably damaging 1.00
IGL03183:Corin APN 5 72,458,929 (GRCm39) missense probably damaging 0.99
IGL03185:Corin APN 5 72,490,124 (GRCm39) missense probably damaging 1.00
IGL03408:Corin APN 5 72,500,304 (GRCm39) missense probably benign 0.40
alpaca UTSW 5 72,661,295 (GRCm39) missense possibly damaging 0.85
R0078:Corin UTSW 5 72,611,816 (GRCm39) missense possibly damaging 0.77
R0724:Corin UTSW 5 72,490,138 (GRCm39) splice site probably benign
R1065:Corin UTSW 5 72,458,993 (GRCm39) nonsense probably null
R1301:Corin UTSW 5 72,462,276 (GRCm39) missense possibly damaging 0.81
R1466:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1466:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1520:Corin UTSW 5 72,488,238 (GRCm39) missense probably damaging 1.00
R1584:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1617:Corin UTSW 5 72,661,295 (GRCm39) missense possibly damaging 0.85
R1912:Corin UTSW 5 72,515,746 (GRCm39) missense probably damaging 1.00
R2059:Corin UTSW 5 72,473,394 (GRCm39) missense possibly damaging 0.76
R2173:Corin UTSW 5 72,661,422 (GRCm39) missense probably benign 0.01
R2242:Corin UTSW 5 72,490,054 (GRCm39) missense probably damaging 1.00
R2373:Corin UTSW 5 72,496,381 (GRCm39) missense probably damaging 1.00
R2850:Corin UTSW 5 72,462,298 (GRCm39) missense probably damaging 1.00
R3683:Corin UTSW 5 72,488,198 (GRCm39) missense probably damaging 1.00
R3684:Corin UTSW 5 72,488,198 (GRCm39) missense probably damaging 1.00
R3790:Corin UTSW 5 72,592,641 (GRCm39) missense probably benign 0.38
R3847:Corin UTSW 5 72,579,508 (GRCm39) missense probably benign 0.13
R3926:Corin UTSW 5 72,529,473 (GRCm39) missense probably damaging 1.00
R3939:Corin UTSW 5 72,497,222 (GRCm39) missense possibly damaging 0.80
R3945:Corin UTSW 5 72,515,767 (GRCm39) missense probably damaging 1.00
R4079:Corin UTSW 5 72,661,226 (GRCm39) missense probably benign 0.03
R4224:Corin UTSW 5 72,500,451 (GRCm39) missense probably damaging 1.00
R4473:Corin UTSW 5 72,496,400 (GRCm39) missense probably damaging 1.00
R4585:Corin UTSW 5 72,487,042 (GRCm39) missense probably damaging 1.00
R4586:Corin UTSW 5 72,487,042 (GRCm39) missense probably damaging 1.00
R4849:Corin UTSW 5 72,460,178 (GRCm39) missense probably damaging 1.00
R4926:Corin UTSW 5 72,529,525 (GRCm39) missense probably damaging 1.00
R5080:Corin UTSW 5 72,511,194 (GRCm39) intron probably benign
R5138:Corin UTSW 5 72,496,402 (GRCm39) missense probably damaging 1.00
R5262:Corin UTSW 5 72,462,298 (GRCm39) missense probably damaging 1.00
R5268:Corin UTSW 5 72,500,362 (GRCm39) missense probably damaging 1.00
R5302:Corin UTSW 5 72,473,441 (GRCm39) missense probably benign 0.07
R5307:Corin UTSW 5 72,514,321 (GRCm39) missense probably damaging 1.00
R5324:Corin UTSW 5 72,592,600 (GRCm39) missense probably damaging 1.00
R5352:Corin UTSW 5 72,462,376 (GRCm39) missense probably benign 0.04
R5373:Corin UTSW 5 72,462,296 (GRCm39) missense probably damaging 1.00
R5374:Corin UTSW 5 72,462,296 (GRCm39) missense probably damaging 1.00
R5484:Corin UTSW 5 72,515,827 (GRCm39) missense probably benign 0.15
R5502:Corin UTSW 5 72,473,449 (GRCm39) nonsense probably null
R5544:Corin UTSW 5 72,462,357 (GRCm39) nonsense probably null
R5682:Corin UTSW 5 72,579,497 (GRCm39) missense possibly damaging 0.85
R5818:Corin UTSW 5 72,592,738 (GRCm39) missense probably benign 0.00
R5992:Corin UTSW 5 72,473,732 (GRCm39) missense probably benign 0.01
R6115:Corin UTSW 5 72,518,072 (GRCm39) missense probably damaging 1.00
R6181:Corin UTSW 5 72,529,439 (GRCm39) critical splice donor site probably null
R6317:Corin UTSW 5 72,496,388 (GRCm39) missense probably damaging 1.00
R7053:Corin UTSW 5 72,458,870 (GRCm39) missense probably benign 0.28
R7242:Corin UTSW 5 72,462,398 (GRCm39) missense probably benign 0.14
R7452:Corin UTSW 5 72,592,590 (GRCm39) missense possibly damaging 0.94
R7783:Corin UTSW 5 72,458,967 (GRCm39) missense probably benign 0.26
R7903:Corin UTSW 5 72,458,843 (GRCm39) missense probably benign 0.00
R7956:Corin UTSW 5 72,579,530 (GRCm39) missense probably damaging 0.99
R8007:Corin UTSW 5 72,473,446 (GRCm39) missense probably damaging 0.96
R8125:Corin UTSW 5 72,515,806 (GRCm39) missense probably damaging 0.96
R8215:Corin UTSW 5 72,462,361 (GRCm39) missense probably damaging 1.00
R8251:Corin UTSW 5 72,514,269 (GRCm39) missense probably damaging 1.00
R8364:Corin UTSW 5 72,462,274 (GRCm39) missense probably benign
R8505:Corin UTSW 5 72,592,750 (GRCm39) missense probably benign 0.21
R8746:Corin UTSW 5 72,592,695 (GRCm39) missense probably benign 0.31
R8887:Corin UTSW 5 72,486,953 (GRCm39) critical splice donor site probably null
R9640:Corin UTSW 5 72,592,597 (GRCm39) missense probably benign
Z1177:Corin UTSW 5 72,611,836 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGGACTCACCTACACAG -3'
(R):5'- GTGCCTATATGCTTCTACACAGTTC -3'

Sequencing Primer
(F):5'- TGGACTCACCTACACAGCCTAATTG -3'
(R):5'- GCTTCTACACAGTTCCTTACACATAC -3'
Posted On 2022-07-18