Incidental Mutation 'R9484:Corin'
ID 716431
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Name corin
Synonyms Lrp4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 72300025-72504473 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72339937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 615 (V615I)
Ref Sequence ENSEMBL: ENSMUSP00000005352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
AlphaFold Q9Z319
Predicted Effect probably damaging
Transcript: ENSMUST00000005352
AA Change: V615I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: V615I

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167460
AA Change: V549I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: V549I

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175766
AA Change: V474I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: V474I

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176974
AA Change: V512I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: V512I

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177290
AA Change: V482I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: V482I

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,112,786 C151S probably damaging Het
Actr8 T C 14: 29,986,344 I193T probably benign Het
Btbd2 T C 10: 80,644,269 N419S probably benign Het
Cacna2d1 T A 5: 16,356,833 W821R probably damaging Het
Cadps2 T C 6: 23,626,647 Y214C probably benign Het
Calu T A 6: 29,366,163 L180Q probably damaging Het
Cyp8b1 A T 9: 121,915,917 D116E probably benign Het
D630036H23Rik C A 12: 36,381,712 A96S unknown Het
Ddx24 A T 12: 103,411,296 Y717N probably damaging Het
Dmap1 G T 4: 117,676,111 Q249K probably benign Het
Dnah10 T A 5: 124,823,444 W3922R probably damaging Het
Dnah14 T C 1: 181,690,208 F2036L probably benign Het
Dnah14 T C 1: 181,797,746 I4064T probably benign Het
Dock9 A C 14: 121,581,432 V1546G probably damaging Het
Eif3a A T 19: 60,766,568 S1059T unknown Het
Ep300 A G 15: 81,636,825 E1262G unknown Het
Evl T A 12: 108,686,457 I387N probably damaging Het
Fat2 A C 11: 55,309,926 V774G probably damaging Het
Fez1 T A 9: 36,843,797 Y31N probably benign Het
Fkbp10 A G 11: 100,423,134 I435V probably damaging Het
Flnb A G 14: 7,929,004 D1911G probably benign Het
Fnbp1 T C 2: 31,083,026 Y154C probably benign Het
Fndc10 T C 4: 155,695,039 I180T possibly damaging Het
Frmd4a G A 2: 4,604,215 V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 H64R possibly damaging Het
Glis3 T C 19: 28,531,003 D527G probably damaging Het
Gm2022 A T 12: 87,895,479 Q37L possibly damaging Het
H2-Ob T A 17: 34,241,015 F33L probably damaging Het
Hbb-bh1 C T 7: 103,843,032 E27K probably benign Het
Ifnb1 T A 4: 88,522,678 T33S probably benign Het
Igkv4-80 T A 6: 69,016,782 T42S probably damaging Het
Irs2 C T 8: 11,007,334 G366D probably damaging Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Krtap5-3 T A 7: 142,202,331 C302S unknown Het
Lgi1 A G 19: 38,306,309 K510E probably benign Het
Lgi2 T A 5: 52,538,594 D341V probably benign Het
Lin7c T C 2: 109,894,468 I14T probably benign Het
Lrrc19 A T 4: 94,643,336 M13K probably benign Het
Lrrc69 T C 4: 14,666,012 I315M probably benign Het
Myo5c A T 9: 75,297,488 D1541V probably damaging Het
Mypn T G 10: 63,167,240 M373L probably benign Het
Nckipsd C A 9: 108,812,638 H333N probably damaging Het
Nrg2 A T 18: 36,024,348 L428Q probably null Het
Olfr1367 C A 13: 21,347,417 T163K probably damaging Het
Olfr235 T C 19: 12,268,371 I47T possibly damaging Het
Olfr53 T C 7: 140,651,991 L4S probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otogl C T 10: 107,901,295 G86D probably damaging Het
Papln A T 12: 83,791,844 Q1249L probably benign Het
Plxna2 G T 1: 194,644,894 G379C probably damaging Het
Pofut2 T C 10: 77,259,426 I35T probably benign Het
Pros1 A G 16: 62,924,524 T501A possibly damaging Het
Rapgef1 T C 2: 29,735,809 S1042P possibly damaging Het
Rps6kb1 C T 11: 86,517,617 E185K probably damaging Het
Slc13a2 A T 11: 78,403,407 L216Q probably damaging Het
Slc22a14 T C 9: 119,180,549 Y160C probably damaging Het
Slc22a4 T A 11: 53,988,947 I429F possibly damaging Het
Slc26a3 A G 12: 31,461,786 K457E probably damaging Het
Slc47a2 T C 11: 61,336,234 I169M possibly damaging Het
Slco1a1 C T 6: 141,908,946 V660I probably benign Het
Smyd1 A G 6: 71,225,466 Y252H probably damaging Het
Soga3 G A 10: 29,196,973 D754N probably damaging Het
Spp2 A T 1: 88,406,973 probably benign Het
Stra8 T A 6: 34,934,186 W250R probably damaging Het
Syne1 A C 10: 5,220,359 L5183R probably damaging Het
Tdrd9 T C 12: 112,046,250 S1203P probably damaging Het
Th C A 7: 142,899,883 E27* probably null Het
Thada C A 17: 84,429,191 L887F probably damaging Het
Timm23 T C 14: 32,180,629 T186A probably benign Het
Tmem132b A T 5: 125,783,356 E555V probably damaging Het
Tnik A T 3: 28,594,944 Q457L unknown Het
Uba7 C A 9: 107,983,838 H942Q probably benign Het
Upf2 T C 2: 5,961,267 S233P unknown Het
Urm1 T A 2: 29,842,748 N72K probably damaging Het
Usp10 T C 8: 119,948,765 S508P possibly damaging Het
Usp37 G A 1: 74,459,922 P632S probably damaging Het
Wdr77 T A 3: 105,965,088 N209K probably benign Het
Zbtb24 C T 10: 41,451,433 T105M probably benign Het
Zfp341 T A 2: 154,643,843 I671N probably damaging Het
Zfp414 A G 17: 33,630,010 T73A probably benign Het
Zfp574 A T 7: 25,081,979 I809F possibly damaging Het
Zfp62 T C 11: 49,217,281 I733T probably damaging Het
Zfp719 A G 7: 43,590,157 I390V possibly damaging Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72304888 missense probably damaging 1.00
IGL01114:Corin APN 5 72305011 missense probably damaging 1.00
IGL01351:Corin APN 5 72338991 missense probably damaging 1.00
IGL01516:Corin APN 5 72454487 nonsense probably null
IGL01785:Corin APN 5 72339876 missense probably damaging 1.00
IGL01786:Corin APN 5 72339876 missense probably damaging 1.00
IGL01845:Corin APN 5 72353939 missense probably damaging 1.00
IGL02097:Corin APN 5 72372146 missense probably damaging 1.00
IGL02629:Corin APN 5 72332673 missense probably damaging 1.00
IGL03085:Corin APN 5 72353930 missense probably damaging 1.00
IGL03120:Corin APN 5 72360689 missense probably damaging 1.00
IGL03150:Corin APN 5 72302858 missense probably damaging 1.00
IGL03183:Corin APN 5 72301586 missense probably damaging 0.99
IGL03185:Corin APN 5 72332781 missense probably damaging 1.00
IGL03408:Corin APN 5 72342961 missense probably benign 0.40
alpaca UTSW 5 72503952 missense possibly damaging 0.85
R0078:Corin UTSW 5 72454473 missense possibly damaging 0.77
R0724:Corin UTSW 5 72332795 splice site probably benign
R1065:Corin UTSW 5 72301650 nonsense probably null
R1301:Corin UTSW 5 72304933 missense possibly damaging 0.81
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1520:Corin UTSW 5 72330895 missense probably damaging 1.00
R1584:Corin UTSW 5 72302790 critical splice donor site probably null
R1617:Corin UTSW 5 72503952 missense possibly damaging 0.85
R1912:Corin UTSW 5 72358403 missense probably damaging 1.00
R2059:Corin UTSW 5 72316051 missense possibly damaging 0.76
R2173:Corin UTSW 5 72504079 missense probably benign 0.01
R2242:Corin UTSW 5 72332711 missense probably damaging 1.00
R2373:Corin UTSW 5 72339038 missense probably damaging 1.00
R2850:Corin UTSW 5 72304955 missense probably damaging 1.00
R3683:Corin UTSW 5 72330855 missense probably damaging 1.00
R3684:Corin UTSW 5 72330855 missense probably damaging 1.00
R3790:Corin UTSW 5 72435298 missense probably benign 0.38
R3847:Corin UTSW 5 72422165 missense probably benign 0.13
R3926:Corin UTSW 5 72372130 missense probably damaging 1.00
R3939:Corin UTSW 5 72339879 missense possibly damaging 0.80
R3945:Corin UTSW 5 72358424 missense probably damaging 1.00
R4079:Corin UTSW 5 72503883 missense probably benign 0.03
R4224:Corin UTSW 5 72343108 missense probably damaging 1.00
R4473:Corin UTSW 5 72339057 missense probably damaging 1.00
R4585:Corin UTSW 5 72329699 missense probably damaging 1.00
R4586:Corin UTSW 5 72329699 missense probably damaging 1.00
R4849:Corin UTSW 5 72302835 missense probably damaging 1.00
R4926:Corin UTSW 5 72372182 missense probably damaging 1.00
R5080:Corin UTSW 5 72353851 intron probably benign
R5138:Corin UTSW 5 72339059 missense probably damaging 1.00
R5262:Corin UTSW 5 72304955 missense probably damaging 1.00
R5268:Corin UTSW 5 72343019 missense probably damaging 1.00
R5302:Corin UTSW 5 72316098 missense probably benign 0.07
R5307:Corin UTSW 5 72356978 missense probably damaging 1.00
R5324:Corin UTSW 5 72435257 missense probably damaging 1.00
R5352:Corin UTSW 5 72305033 missense probably benign 0.04
R5373:Corin UTSW 5 72304953 missense probably damaging 1.00
R5374:Corin UTSW 5 72304953 missense probably damaging 1.00
R5484:Corin UTSW 5 72358484 missense probably benign 0.15
R5502:Corin UTSW 5 72316106 nonsense probably null
R5544:Corin UTSW 5 72305014 nonsense probably null
R5682:Corin UTSW 5 72422154 missense possibly damaging 0.85
R5818:Corin UTSW 5 72435395 missense probably benign 0.00
R5992:Corin UTSW 5 72316389 missense probably benign 0.01
R6115:Corin UTSW 5 72360729 missense probably damaging 1.00
R6181:Corin UTSW 5 72372096 critical splice donor site probably null
R6317:Corin UTSW 5 72339045 missense probably damaging 1.00
R7053:Corin UTSW 5 72301527 missense probably benign 0.28
R7242:Corin UTSW 5 72305055 missense probably benign 0.14
R7452:Corin UTSW 5 72435247 missense possibly damaging 0.94
R7783:Corin UTSW 5 72301624 missense probably benign 0.26
R7903:Corin UTSW 5 72301500 missense probably benign 0.00
R7956:Corin UTSW 5 72422187 missense probably damaging 0.99
R8007:Corin UTSW 5 72316103 missense probably damaging 0.96
R8125:Corin UTSW 5 72358463 missense probably damaging 0.96
R8215:Corin UTSW 5 72305018 missense probably damaging 1.00
R8251:Corin UTSW 5 72356926 missense probably damaging 1.00
R8364:Corin UTSW 5 72304931 missense probably benign
R8505:Corin UTSW 5 72435407 missense probably benign 0.21
R8746:Corin UTSW 5 72435352 missense probably benign 0.31
R8887:Corin UTSW 5 72329610 critical splice donor site probably null
R9640:Corin UTSW 5 72435254 missense probably benign
Z1177:Corin UTSW 5 72454493 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGGACTCACCTACACAG -3'
(R):5'- GTGCCTATATGCTTCTACACAGTTC -3'

Sequencing Primer
(F):5'- TGGACTCACCTACACAGCCTAATTG -3'
(R):5'- GCTTCTACACAGTTCCTTACACATAC -3'
Posted On 2022-07-18