Incidental Mutation 'R9484:Tmem132b'
ID 716434
Institutional Source Beutler Lab
Gene Symbol Tmem132b
Ensembl Gene ENSMUSG00000070498
Gene Name transmembrane protein 132B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 125531774-125792583 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125783356 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 555 (E555V)
Ref Sequence ENSEMBL: ENSMUSP00000031446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031446]
AlphaFold F7BAB2
Predicted Effect probably damaging
Transcript: ENSMUST00000031446
AA Change: E555V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031446
Gene: ENSMUSG00000070498
AA Change: E555V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM132D_N 44 173 2.9e-53 PFAM
Pfam:TMEM132 432 774 5.9e-145 PFAM
Pfam:TMEM132D_C 870 953 1.3e-36 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,112,786 C151S probably damaging Het
Actr8 T C 14: 29,986,344 I193T probably benign Het
Btbd2 T C 10: 80,644,269 N419S probably benign Het
Cacna2d1 T A 5: 16,356,833 W821R probably damaging Het
Cadps2 T C 6: 23,626,647 Y214C probably benign Het
Calu T A 6: 29,366,163 L180Q probably damaging Het
Corin C T 5: 72,339,937 V615I probably damaging Het
Cyp8b1 A T 9: 121,915,917 D116E probably benign Het
D630036H23Rik C A 12: 36,381,712 A96S unknown Het
Ddx24 A T 12: 103,411,296 Y717N probably damaging Het
Dmap1 G T 4: 117,676,111 Q249K probably benign Het
Dnah10 T A 5: 124,823,444 W3922R probably damaging Het
Dnah14 T C 1: 181,690,208 F2036L probably benign Het
Dnah14 T C 1: 181,797,746 I4064T probably benign Het
Dock9 A C 14: 121,581,432 V1546G probably damaging Het
Eif3a A T 19: 60,766,568 S1059T unknown Het
Ep300 A G 15: 81,636,825 E1262G unknown Het
Evl T A 12: 108,686,457 I387N probably damaging Het
Fat2 A C 11: 55,309,926 V774G probably damaging Het
Fez1 T A 9: 36,843,797 Y31N probably benign Het
Fkbp10 A G 11: 100,423,134 I435V probably damaging Het
Flnb A G 14: 7,929,004 D1911G probably benign Het
Fnbp1 T C 2: 31,083,026 Y154C probably benign Het
Fndc10 T C 4: 155,695,039 I180T possibly damaging Het
Frmd4a G A 2: 4,604,215 V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 H64R possibly damaging Het
Glis3 T C 19: 28,531,003 D527G probably damaging Het
Gm2022 A T 12: 87,895,479 Q37L possibly damaging Het
H2-Ob T A 17: 34,241,015 F33L probably damaging Het
Hbb-bh1 C T 7: 103,843,032 E27K probably benign Het
Ifnb1 T A 4: 88,522,678 T33S probably benign Het
Igkv4-80 T A 6: 69,016,782 T42S probably damaging Het
Irs2 C T 8: 11,007,334 G366D probably damaging Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Krtap5-3 T A 7: 142,202,331 C302S unknown Het
Lgi1 A G 19: 38,306,309 K510E probably benign Het
Lgi2 T A 5: 52,538,594 D341V probably benign Het
Lin7c T C 2: 109,894,468 I14T probably benign Het
Lrrc19 A T 4: 94,643,336 M13K probably benign Het
Lrrc69 T C 4: 14,666,012 I315M probably benign Het
Myo5c A T 9: 75,297,488 D1541V probably damaging Het
Mypn T G 10: 63,167,240 M373L probably benign Het
Nckipsd C A 9: 108,812,638 H333N probably damaging Het
Nrg2 A T 18: 36,024,348 L428Q probably null Het
Olfr1367 C A 13: 21,347,417 T163K probably damaging Het
Olfr235 T C 19: 12,268,371 I47T possibly damaging Het
Olfr53 T C 7: 140,651,991 L4S probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otogl C T 10: 107,901,295 G86D probably damaging Het
Papln A T 12: 83,791,844 Q1249L probably benign Het
Plxna2 G T 1: 194,644,894 G379C probably damaging Het
Pofut2 T C 10: 77,259,426 I35T probably benign Het
Pros1 A G 16: 62,924,524 T501A possibly damaging Het
Rapgef1 T C 2: 29,735,809 S1042P possibly damaging Het
Rps6kb1 C T 11: 86,517,617 E185K probably damaging Het
Slc13a2 A T 11: 78,403,407 L216Q probably damaging Het
Slc22a14 T C 9: 119,180,549 Y160C probably damaging Het
Slc22a4 T A 11: 53,988,947 I429F possibly damaging Het
Slc26a3 A G 12: 31,461,786 K457E probably damaging Het
Slc47a2 T C 11: 61,336,234 I169M possibly damaging Het
Slco1a1 C T 6: 141,908,946 V660I probably benign Het
Smyd1 A G 6: 71,225,466 Y252H probably damaging Het
Soga3 G A 10: 29,196,973 D754N probably damaging Het
Spp2 A T 1: 88,406,973 probably benign Het
Stra8 T A 6: 34,934,186 W250R probably damaging Het
Syne1 A C 10: 5,220,359 L5183R probably damaging Het
Tdrd9 T C 12: 112,046,250 S1203P probably damaging Het
Th C A 7: 142,899,883 E27* probably null Het
Thada C A 17: 84,429,191 L887F probably damaging Het
Timm23 T C 14: 32,180,629 T186A probably benign Het
Tnik A T 3: 28,594,944 Q457L unknown Het
Uba7 C A 9: 107,983,838 H942Q probably benign Het
Upf2 T C 2: 5,961,267 S233P unknown Het
Urm1 T A 2: 29,842,748 N72K probably damaging Het
Usp10 T C 8: 119,948,765 S508P possibly damaging Het
Usp37 G A 1: 74,459,922 P632S probably damaging Het
Wdr77 T A 3: 105,965,088 N209K probably benign Het
Zbtb24 C T 10: 41,451,433 T105M probably benign Het
Zfp341 T A 2: 154,643,843 I671N probably damaging Het
Zfp414 A G 17: 33,630,010 T73A probably benign Het
Zfp574 A T 7: 25,081,979 I809F possibly damaging Het
Zfp62 T C 11: 49,217,281 I733T probably damaging Het
Zfp719 A G 7: 43,590,157 I390V possibly damaging Het
Other mutations in Tmem132b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Tmem132b APN 5 125698728 missense probably benign
IGL01518:Tmem132b APN 5 125778791 missense probably damaging 1.00
IGL02542:Tmem132b APN 5 125622494 missense probably damaging 1.00
IGL02652:Tmem132b APN 5 125787575 missense probably damaging 1.00
IGL02671:Tmem132b APN 5 125778727 missense probably damaging 0.97
IGL02951:Tmem132b APN 5 125787547 missense probably damaging 0.99
R0456:Tmem132b UTSW 5 125787724 missense probably damaging 0.99
R0462:Tmem132b UTSW 5 125785926 missense probably damaging 1.00
R0724:Tmem132b UTSW 5 125783421 missense possibly damaging 0.95
R1137:Tmem132b UTSW 5 125783542 missense possibly damaging 0.94
R1168:Tmem132b UTSW 5 125787019 missense probably damaging 0.99
R1418:Tmem132b UTSW 5 125638249 missense probably benign 0.01
R1689:Tmem132b UTSW 5 125787614 missense possibly damaging 0.95
R1744:Tmem132b UTSW 5 125778844 critical splice donor site probably null
R1835:Tmem132b UTSW 5 125785899 missense probably damaging 1.00
R2016:Tmem132b UTSW 5 125623016 missense probably benign
R2033:Tmem132b UTSW 5 125749289 missense probably damaging 0.98
R2097:Tmem132b UTSW 5 125638208 missense probably damaging 0.99
R2114:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2116:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2117:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2870:Tmem132b UTSW 5 125638268 missense probably benign
R2870:Tmem132b UTSW 5 125638268 missense probably benign
R3807:Tmem132b UTSW 5 125787580 missense probably damaging 1.00
R4825:Tmem132b UTSW 5 125783433 missense probably benign
R5149:Tmem132b UTSW 5 125622925 missense probably damaging 0.99
R5484:Tmem132b UTSW 5 125787733 missense probably damaging 1.00
R5623:Tmem132b UTSW 5 125623352 missense probably damaging 0.99
R5624:Tmem132b UTSW 5 125622646 missense probably benign 0.04
R5775:Tmem132b UTSW 5 125638330 critical splice donor site probably null
R7012:Tmem132b UTSW 5 125698590 missense probably damaging 1.00
R7142:Tmem132b UTSW 5 125622673 missense probably damaging 1.00
R7308:Tmem132b UTSW 5 125787646 missense possibly damaging 0.88
R7414:Tmem132b UTSW 5 125787491 missense probably damaging 1.00
R7452:Tmem132b UTSW 5 125638268 missense probably benign
R7650:Tmem132b UTSW 5 125787010 missense probably benign 0.04
R8111:Tmem132b UTSW 5 125622793 missense probably benign 0.00
R8326:Tmem132b UTSW 5 125787554 missense probably damaging 1.00
R8525:Tmem132b UTSW 5 125638316 missense probably benign 0.01
R8900:Tmem132b UTSW 5 125778820 missense probably damaging 0.96
R9147:Tmem132b UTSW 5 125787103 missense probably damaging 1.00
R9148:Tmem132b UTSW 5 125787103 missense probably damaging 1.00
R9179:Tmem132b UTSW 5 125623051 missense probably benign 0.02
R9215:Tmem132b UTSW 5 125787116 missense probably damaging 0.99
R9231:Tmem132b UTSW 5 125783467 missense probably damaging 1.00
R9284:Tmem132b UTSW 5 125787647 missense possibly damaging 0.67
R9311:Tmem132b UTSW 5 125785965 missense possibly damaging 0.56
R9436:Tmem132b UTSW 5 125698569 missense possibly damaging 0.53
R9775:Tmem132b UTSW 5 125787502 missense probably benign 0.07
Z1176:Tmem132b UTSW 5 125787886 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GCTGTTGACAATTAGGGGTCAG -3'
(R):5'- CTGCCATTCTGTAACTGGGC -3'

Sequencing Primer
(F):5'- TGCATGAGTGGATGAATGAATTC -3'
(R):5'- CCATTCTGTAACTGGGCAATTTTTG -3'
Posted On 2022-07-18