Mutagenetix > Incidental Mutation

Incidental Mutation 'R9484:Cadps2'

716435

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9484 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23626647 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 214 (Y214C)

Ref Sequence

ENSEMBL: ENSMUSP00000111018 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000018122
AA Change: Y214C

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: Y214C

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000069074
AA Change: Y214C

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: Y214C

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115356
AA Change: Y214C

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: Y214C

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115358
AA Change: Y214C

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: Y214C

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115361
AA Change: Y214C

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: Y214C

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142913
AA Change: Y185C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: Y185C

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163871
AA Change: Y214C

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: Y214C

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: Y185C

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.2%
20x: 97.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acads	A	T	5: 115,112,786	C151S	probably damaging	Het
Actr8	T	C	14: 29,986,344	I193T	probably benign	Het
Btbd2	T	C	10: 80,644,269	N419S	probably benign	Het
Cacna2d1	T	A	5: 16,356,833	W821R	probably damaging	Het
Calu	T	A	6: 29,366,163	L180Q	probably damaging	Het
Corin	C	T	5: 72,339,937	V615I	probably damaging	Het
Cyp8b1	A	T	9: 121,915,917	D116E	probably benign	Het
D630036H23Rik	C	A	12: 36,381,712	A96S	unknown	Het
Ddx24	A	T	12: 103,411,296	Y717N	probably damaging	Het
Dmap1	G	T	4: 117,676,111	Q249K	probably benign	Het
Dnah10	T	A	5: 124,823,444	W3922R	probably damaging	Het
Dnah14	T	C	1: 181,690,208	F2036L	probably benign	Het
Dnah14	T	C	1: 181,797,746	I4064T	probably benign	Het
Dock9	A	C	14: 121,581,432	V1546G	probably damaging	Het
Eif3a	A	T	19: 60,766,568	S1059T	unknown	Het
Ep300	A	G	15: 81,636,825	E1262G	unknown	Het
Evl	T	A	12: 108,686,457	I387N	probably damaging	Het
Fat2	A	C	11: 55,309,926	V774G	probably damaging	Het
Fez1	T	A	9: 36,843,797	Y31N	probably benign	Het
Fkbp10	A	G	11: 100,423,134	I435V	probably damaging	Het
Flnb	A	G	14: 7,929,004	D1911G	probably benign	Het
Fnbp1	T	C	2: 31,083,026	Y154C	probably benign	Het
Fndc10	T	C	4: 155,695,039	I180T	possibly damaging	Het
Frmd4a	G	A	2: 4,604,215	V965I	possibly damaging	Het
Gabrr2	A	G	4: 33,071,352	H64R	possibly damaging	Het
Glis3	T	C	19: 28,531,003	D527G	probably damaging	Het
Gm2022	A	T	12: 87,895,479	Q37L	possibly damaging	Het
H2-Ob	T	A	17: 34,241,015	F33L	probably damaging	Het
Hbb-bh1	C	T	7: 103,843,032	E27K	probably benign	Het
Ifnb1	T	A	4: 88,522,678	T33S	probably benign	Het
Igkv4-80	T	A	6: 69,016,782	T42S	probably damaging	Het
Irs2	C	T	8: 11,007,334	G366D	probably damaging	Het
Kcnk2	CAAA	CAA	1: 189,256,694		probably null	Het
Krtap5-3	T	A	7: 142,202,331	C302S	unknown	Het
Lgi1	A	G	19: 38,306,309	K510E	probably benign	Het
Lgi2	T	A	5: 52,538,594	D341V	probably benign	Het
Lin7c	T	C	2: 109,894,468	I14T	probably benign	Het
Lrrc19	A	T	4: 94,643,336	M13K	probably benign	Het
Lrrc69	T	C	4: 14,666,012	I315M	probably benign	Het
Myo5c	A	T	9: 75,297,488	D1541V	probably damaging	Het
Mypn	T	G	10: 63,167,240	M373L	probably benign	Het
Nckipsd	C	A	9: 108,812,638	H333N	probably damaging	Het
Nrg2	A	T	18: 36,024,348	L428Q	probably null	Het
Olfr1367	C	A	13: 21,347,417	T163K	probably damaging	Het
Olfr235	T	C	19: 12,268,371	I47T	possibly damaging	Het
Olfr53	T	C	7: 140,651,991	L4S	probably benign	Het
Otogl	T	A	10: 107,822,033		probably null	Het
Otogl	C	T	10: 107,901,295	G86D	probably damaging	Het
Papln	A	T	12: 83,791,844	Q1249L	probably benign	Het
Plxna2	G	T	1: 194,644,894	G379C	probably damaging	Het
Pofut2	T	C	10: 77,259,426	I35T	probably benign	Het
Pros1	A	G	16: 62,924,524	T501A	possibly damaging	Het
Rapgef1	T	C	2: 29,735,809	S1042P	possibly damaging	Het
Rps6kb1	C	T	11: 86,517,617	E185K	probably damaging	Het
Slc13a2	A	T	11: 78,403,407	L216Q	probably damaging	Het
Slc22a14	T	C	9: 119,180,549	Y160C	probably damaging	Het
Slc22a4	T	A	11: 53,988,947	I429F	possibly damaging	Het
Slc26a3	A	G	12: 31,461,786	K457E	probably damaging	Het
Slc47a2	T	C	11: 61,336,234	I169M	possibly damaging	Het
Slco1a1	C	T	6: 141,908,946	V660I	probably benign	Het
Smyd1	A	G	6: 71,225,466	Y252H	probably damaging	Het
Soga3	G	A	10: 29,196,973	D754N	probably damaging	Het
Spp2	A	T	1: 88,406,973		probably benign	Het
Stra8	T	A	6: 34,934,186	W250R	probably damaging	Het
Syne1	A	C	10: 5,220,359	L5183R	probably damaging	Het
Tdrd9	T	C	12: 112,046,250	S1203P	probably damaging	Het
Th	C	A	7: 142,899,883	E27*	probably null	Het
Thada	C	A	17: 84,429,191	L887F	probably damaging	Het
Timm23	T	C	14: 32,180,629	T186A	probably benign	Het
Tmem132b	A	T	5: 125,783,356	E555V	probably damaging	Het
Tnik	A	T	3: 28,594,944	Q457L	unknown	Het
Uba7	C	A	9: 107,983,838	H942Q	probably benign	Het
Upf2	T	C	2: 5,961,267	S233P	unknown	Het
Urm1	T	A	2: 29,842,748	N72K	probably damaging	Het
Usp10	T	C	8: 119,948,765	S508P	possibly damaging	Het
Usp37	G	A	1: 74,459,922	P632S	probably damaging	Het
Wdr77	T	A	3: 105,965,088	N209K	probably benign	Het
Zbtb24	C	T	10: 41,451,433	T105M	probably benign	Het
Zfp341	T	A	2: 154,643,843	I671N	probably damaging	Het
Zfp414	A	G	17: 33,630,010	T73A	probably benign	Het
Zfp574	A	T	7: 25,081,979	I809F	possibly damaging	Het
Zfp62	T	C	11: 49,217,281	I733T	probably damaging	Het
Zfp719	A	G	7: 43,590,157	I390V	possibly damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
R9447:Cadps2	UTSW	6	23323298	missense	probably damaging	0.96
R9492:Cadps2	UTSW	6	23427239	missense	probably benign
R9630:Cadps2	UTSW	6	23587572	missense	probably benign	0.08
R9729:Cadps2	UTSW	6	23382983	missense	probably benign	0.28
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCCAGGGTCATACACACTCC -3'
(R):5'- CTAAAGAGTGACCGTGTGGC -3'

Sequencing Primer
(F):5'- CTTGCATGCATCAGACGTG -3'
(R):5'- TGACCGTGTGGCCAGAATG -3'

Posted On

2022-07-18