Incidental Mutation 'R9484:Irs2'
ID 716447
Institutional Source Beutler Lab
Gene Symbol Irs2
Ensembl Gene ENSMUSG00000038894
Gene Name insulin receptor substrate 2
Synonyms Irs-2
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.579) question?
Stock # R9484 (G1)
Quality Score 168.009
Status Not validated
Chromosome 8
Chromosomal Location 11034681-11058458 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11057334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 366 (G366D)
Ref Sequence ENSEMBL: ENSMUSP00000038514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040514]
AlphaFold P81122
PDB Structure Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040514
AA Change: G366D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: G366D

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 19 28 N/A INTRINSIC
PH 31 146 2.83e-13 SMART
IRS 191 293 4.98e-38 SMART
PTBI 191 293 2.24e-51 SMART
low complexity region 301 309 N/A INTRINSIC
low complexity region 364 377 N/A INTRINSIC
low complexity region 435 473 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 688 710 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
low complexity region 834 846 N/A INTRINSIC
low complexity region 923 959 N/A INTRINSIC
low complexity region 976 984 N/A INTRINSIC
low complexity region 997 1028 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
low complexity region 1274 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,250,845 (GRCm39) C151S probably damaging Het
Actr8 T C 14: 29,708,301 (GRCm39) I193T probably benign Het
Btbd2 T C 10: 80,480,103 (GRCm39) N419S probably benign Het
Cacna2d1 T A 5: 16,561,831 (GRCm39) W821R probably damaging Het
Cadps2 T C 6: 23,626,646 (GRCm39) Y214C probably benign Het
Calu T A 6: 29,366,162 (GRCm39) L180Q probably damaging Het
Corin C T 5: 72,497,280 (GRCm39) V615I probably damaging Het
Cyp8b1 A T 9: 121,744,983 (GRCm39) D116E probably benign Het
D630036H23Rik C A 12: 36,431,711 (GRCm39) A96S unknown Het
Ddx24 A T 12: 103,377,555 (GRCm39) Y717N probably damaging Het
Dmap1 G T 4: 117,533,308 (GRCm39) Q249K probably benign Het
Dnah10 T A 5: 124,900,508 (GRCm39) W3922R probably damaging Het
Dnah14 T C 1: 181,517,773 (GRCm39) F2036L probably benign Het
Dnah14 T C 1: 181,625,311 (GRCm39) I4064T probably benign Het
Dock9 A C 14: 121,818,844 (GRCm39) V1546G probably damaging Het
Eif1ad4 A T 12: 87,862,249 (GRCm39) Q37L possibly damaging Het
Eif3a A T 19: 60,755,006 (GRCm39) S1059T unknown Het
Ep300 A G 15: 81,521,026 (GRCm39) E1262G unknown Het
Evl T A 12: 108,652,716 (GRCm39) I387N probably damaging Het
Fat2 A C 11: 55,200,752 (GRCm39) V774G probably damaging Het
Fez1 T A 9: 36,755,093 (GRCm39) Y31N probably benign Het
Fkbp10 A G 11: 100,313,960 (GRCm39) I435V probably damaging Het
Flnb A G 14: 7,929,004 (GRCm38) D1911G probably benign Het
Fnbp1 T C 2: 30,973,038 (GRCm39) Y154C probably benign Het
Fndc10 T C 4: 155,779,496 (GRCm39) I180T possibly damaging Het
Frmd4a G A 2: 4,609,026 (GRCm39) V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 (GRCm39) H64R possibly damaging Het
Glis3 T C 19: 28,508,403 (GRCm39) D527G probably damaging Het
H2-Ob T A 17: 34,459,989 (GRCm39) F33L probably damaging Het
Hbb-bh1 C T 7: 103,492,239 (GRCm39) E27K probably benign Het
Ifnb1 T A 4: 88,440,915 (GRCm39) T33S probably benign Het
Igkv4-80 T A 6: 68,993,766 (GRCm39) T42S probably damaging Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,068 (GRCm39) C302S unknown Het
Lgi1 A G 19: 38,294,757 (GRCm39) K510E probably benign Het
Lgi2 T A 5: 52,695,936 (GRCm39) D341V probably benign Het
Lin7c T C 2: 109,724,813 (GRCm39) I14T probably benign Het
Lrrc19 A T 4: 94,531,573 (GRCm39) M13K probably benign Het
Lrrc69 T C 4: 14,666,012 (GRCm39) I315M probably benign Het
Mtcl3 G A 10: 29,072,969 (GRCm39) D754N probably damaging Het
Myo5c A T 9: 75,204,770 (GRCm39) D1541V probably damaging Het
Mypn T G 10: 63,003,019 (GRCm39) M373L probably benign Het
Nckipsd C A 9: 108,689,837 (GRCm39) H333N probably damaging Het
Nrg2 A T 18: 36,157,401 (GRCm39) L428Q probably null Het
Or13a20 T C 7: 140,231,904 (GRCm39) L4S probably benign Het
Or2b28 C A 13: 21,531,587 (GRCm39) T163K probably damaging Het
Or5an11 T C 19: 12,245,735 (GRCm39) I47T possibly damaging Het
Otogl T A 10: 107,657,894 (GRCm39) probably null Het
Otogl C T 10: 107,737,156 (GRCm39) G86D probably damaging Het
Papln A T 12: 83,838,618 (GRCm39) Q1249L probably benign Het
Plxna2 G T 1: 194,327,202 (GRCm39) G379C probably damaging Het
Pofut2 T C 10: 77,095,260 (GRCm39) I35T probably benign Het
Pros1 A G 16: 62,744,887 (GRCm39) T501A possibly damaging Het
Rapgef1 T C 2: 29,625,821 (GRCm39) S1042P possibly damaging Het
Rps6kb1 C T 11: 86,408,443 (GRCm39) E185K probably damaging Het
Slc13a2 A T 11: 78,294,233 (GRCm39) L216Q probably damaging Het
Slc22a14 T C 9: 119,009,615 (GRCm39) Y160C probably damaging Het
Slc22a4 T A 11: 53,879,773 (GRCm39) I429F possibly damaging Het
Slc26a3 A G 12: 31,511,785 (GRCm39) K457E probably damaging Het
Slc47a2 T C 11: 61,227,060 (GRCm39) I169M possibly damaging Het
Slco1a1 C T 6: 141,854,672 (GRCm39) V660I probably benign Het
Smyd1 A G 6: 71,202,450 (GRCm39) Y252H probably damaging Het
Spp2 A T 1: 88,334,695 (GRCm39) probably benign Het
Stra8 T A 6: 34,911,121 (GRCm39) W250R probably damaging Het
Syne1 A C 10: 5,170,359 (GRCm39) L5183R probably damaging Het
Tdrd9 T C 12: 112,012,684 (GRCm39) S1203P probably damaging Het
Th C A 7: 142,453,620 (GRCm39) E27* probably null Het
Thada C A 17: 84,736,619 (GRCm39) L887F probably damaging Het
Timm23 T C 14: 31,902,586 (GRCm39) T186A probably benign Het
Tmem132b A T 5: 125,860,420 (GRCm39) E555V probably damaging Het
Tnik A T 3: 28,649,093 (GRCm39) Q457L unknown Het
Uba7 C A 9: 107,861,037 (GRCm39) H942Q probably benign Het
Upf2 T C 2: 5,966,078 (GRCm39) S233P unknown Het
Urm1 T A 2: 29,732,760 (GRCm39) N72K probably damaging Het
Usp10 T C 8: 120,675,504 (GRCm39) S508P possibly damaging Het
Usp37 G A 1: 74,499,081 (GRCm39) P632S probably damaging Het
Wdr77 T A 3: 105,872,404 (GRCm39) N209K probably benign Het
Zbtb24 C T 10: 41,327,429 (GRCm39) T105M probably benign Het
Zfp341 T A 2: 154,485,763 (GRCm39) I671N probably damaging Het
Zfp414 A G 17: 33,848,984 (GRCm39) T73A probably benign Het
Zfp574 A T 7: 24,781,404 (GRCm39) I809F possibly damaging Het
Zfp62 T C 11: 49,108,108 (GRCm39) I733T probably damaging Het
Zfp719 A G 7: 43,239,581 (GRCm39) I390V possibly damaging Het
Other mutations in Irs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Irs2 APN 8 11,055,867 (GRCm39) missense probably benign 0.00
IGL01328:Irs2 APN 8 11,054,792 (GRCm39) missense probably damaging 0.99
IGL01875:Irs2 APN 8 11,056,221 (GRCm39) missense probably damaging 0.98
IGL02444:Irs2 APN 8 11,056,306 (GRCm39) missense probably benign 0.03
IGL02448:Irs2 APN 8 11,057,862 (GRCm39) missense probably benign 0.21
IGL02945:Irs2 APN 8 11,057,781 (GRCm39) missense probably damaging 1.00
IGL03068:Irs2 APN 8 11,054,974 (GRCm39) missense probably damaging 0.99
beefed UTSW 8 11,056,522 (GRCm39) nonsense probably null
Dum_dum UTSW 8 11,037,012 (GRCm39) makesense probably null
Lush UTSW 8 11,056,678 (GRCm39) nonsense probably null
muscular UTSW 8 11,054,659 (GRCm39) nonsense probably null
Plink UTSW 8 11,055,121 (GRCm39) missense probably damaging 0.99
R0062:Irs2 UTSW 8 11,055,723 (GRCm39) missense possibly damaging 0.65
R0062:Irs2 UTSW 8 11,055,723 (GRCm39) missense possibly damaging 0.65
R0107:Irs2 UTSW 8 11,054,691 (GRCm39) missense probably damaging 1.00
R0147:Irs2 UTSW 8 11,057,568 (GRCm39) missense probably damaging 1.00
R0501:Irs2 UTSW 8 11,056,396 (GRCm39) missense probably damaging 1.00
R0565:Irs2 UTSW 8 11,054,592 (GRCm39) missense probably damaging 0.98
R2042:Irs2 UTSW 8 11,057,580 (GRCm39) missense probably damaging 0.99
R2268:Irs2 UTSW 8 11,057,586 (GRCm39) missense probably damaging 0.98
R2518:Irs2 UTSW 8 11,055,352 (GRCm39) missense probably benign 0.00
R2762:Irs2 UTSW 8 11,056,408 (GRCm39) missense probably damaging 1.00
R3623:Irs2 UTSW 8 11,057,643 (GRCm39) missense probably damaging 1.00
R3624:Irs2 UTSW 8 11,057,643 (GRCm39) missense probably damaging 1.00
R5022:Irs2 UTSW 8 11,037,012 (GRCm39) makesense probably null
R5270:Irs2 UTSW 8 11,056,678 (GRCm39) nonsense probably null
R5377:Irs2 UTSW 8 11,055,277 (GRCm39) missense probably benign 0.00
R5604:Irs2 UTSW 8 11,055,007 (GRCm39) missense possibly damaging 0.84
R6049:Irs2 UTSW 8 11,056,805 (GRCm39) missense probably benign 0.01
R6219:Irs2 UTSW 8 11,055,121 (GRCm39) missense probably damaging 0.99
R6654:Irs2 UTSW 8 11,056,486 (GRCm39) missense probably damaging 1.00
R6726:Irs2 UTSW 8 11,054,961 (GRCm39) missense possibly damaging 0.86
R6813:Irs2 UTSW 8 11,054,659 (GRCm39) nonsense probably null
R6934:Irs2 UTSW 8 11,054,697 (GRCm39) missense probably damaging 0.99
R7261:Irs2 UTSW 8 11,057,018 (GRCm39) missense possibly damaging 0.95
R7285:Irs2 UTSW 8 11,056,797 (GRCm39) missense probably damaging 0.99
R7458:Irs2 UTSW 8 11,057,739 (GRCm39) missense probably damaging 0.99
R7757:Irs2 UTSW 8 11,056,522 (GRCm39) nonsense probably null
R8347:Irs2 UTSW 8 11,058,000 (GRCm39) missense possibly damaging 0.82
R8348:Irs2 UTSW 8 11,054,974 (GRCm39) missense probably damaging 0.98
R8377:Irs2 UTSW 8 11,054,848 (GRCm39) nonsense probably null
R8444:Irs2 UTSW 8 11,056,683 (GRCm39) missense probably damaging 0.99
R8912:Irs2 UTSW 8 11,056,655 (GRCm39) missense probably damaging 0.96
R9229:Irs2 UTSW 8 11,057,400 (GRCm39) missense probably damaging 1.00
R9344:Irs2 UTSW 8 11,057,289 (GRCm39) nonsense probably null
R9405:Irs2 UTSW 8 11,055,061 (GRCm39) missense possibly damaging 0.95
R9736:Irs2 UTSW 8 11,058,217 (GRCm39) missense probably damaging 1.00
Z1176:Irs2 UTSW 8 11,056,185 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGTCAAGGGACATGAAACCC -3'
(R):5'- CAAAGAGCTCTTCGAGTTCCG -3'

Sequencing Primer
(F):5'- ATGAAACCCGGGTCGCTG -3'
(R):5'- TCGCAGCAAGAGTCAGTC -3'
Posted On 2022-07-18