Incidental Mutation 'R9484:Myo5c'
ID 716450
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Name myosin VC
Synonyms 9130003O20Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 75139302-75212733 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75204770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1541 (D1541V)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555]
AlphaFold E9Q1F5
Predicted Effect probably damaging
Transcript: ENSMUST00000036555
AA Change: D1541V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: D1541V

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,250,845 (GRCm39) C151S probably damaging Het
Actr8 T C 14: 29,708,301 (GRCm39) I193T probably benign Het
Btbd2 T C 10: 80,480,103 (GRCm39) N419S probably benign Het
Cacna2d1 T A 5: 16,561,831 (GRCm39) W821R probably damaging Het
Cadps2 T C 6: 23,626,646 (GRCm39) Y214C probably benign Het
Calu T A 6: 29,366,162 (GRCm39) L180Q probably damaging Het
Corin C T 5: 72,497,280 (GRCm39) V615I probably damaging Het
Cyp8b1 A T 9: 121,744,983 (GRCm39) D116E probably benign Het
D630036H23Rik C A 12: 36,431,711 (GRCm39) A96S unknown Het
Ddx24 A T 12: 103,377,555 (GRCm39) Y717N probably damaging Het
Dmap1 G T 4: 117,533,308 (GRCm39) Q249K probably benign Het
Dnah10 T A 5: 124,900,508 (GRCm39) W3922R probably damaging Het
Dnah14 T C 1: 181,517,773 (GRCm39) F2036L probably benign Het
Dnah14 T C 1: 181,625,311 (GRCm39) I4064T probably benign Het
Dock9 A C 14: 121,818,844 (GRCm39) V1546G probably damaging Het
Eif1ad4 A T 12: 87,862,249 (GRCm39) Q37L possibly damaging Het
Eif3a A T 19: 60,755,006 (GRCm39) S1059T unknown Het
Ep300 A G 15: 81,521,026 (GRCm39) E1262G unknown Het
Evl T A 12: 108,652,716 (GRCm39) I387N probably damaging Het
Fat2 A C 11: 55,200,752 (GRCm39) V774G probably damaging Het
Fez1 T A 9: 36,755,093 (GRCm39) Y31N probably benign Het
Fkbp10 A G 11: 100,313,960 (GRCm39) I435V probably damaging Het
Flnb A G 14: 7,929,004 (GRCm38) D1911G probably benign Het
Fnbp1 T C 2: 30,973,038 (GRCm39) Y154C probably benign Het
Fndc10 T C 4: 155,779,496 (GRCm39) I180T possibly damaging Het
Frmd4a G A 2: 4,609,026 (GRCm39) V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 (GRCm39) H64R possibly damaging Het
Glis3 T C 19: 28,508,403 (GRCm39) D527G probably damaging Het
H2-Ob T A 17: 34,459,989 (GRCm39) F33L probably damaging Het
Hbb-bh1 C T 7: 103,492,239 (GRCm39) E27K probably benign Het
Ifnb1 T A 4: 88,440,915 (GRCm39) T33S probably benign Het
Igkv4-80 T A 6: 68,993,766 (GRCm39) T42S probably damaging Het
Irs2 C T 8: 11,057,334 (GRCm39) G366D probably damaging Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,068 (GRCm39) C302S unknown Het
Lgi1 A G 19: 38,294,757 (GRCm39) K510E probably benign Het
Lgi2 T A 5: 52,695,936 (GRCm39) D341V probably benign Het
Lin7c T C 2: 109,724,813 (GRCm39) I14T probably benign Het
Lrrc19 A T 4: 94,531,573 (GRCm39) M13K probably benign Het
Lrrc69 T C 4: 14,666,012 (GRCm39) I315M probably benign Het
Mtcl3 G A 10: 29,072,969 (GRCm39) D754N probably damaging Het
Mypn T G 10: 63,003,019 (GRCm39) M373L probably benign Het
Nckipsd C A 9: 108,689,837 (GRCm39) H333N probably damaging Het
Nrg2 A T 18: 36,157,401 (GRCm39) L428Q probably null Het
Or13a20 T C 7: 140,231,904 (GRCm39) L4S probably benign Het
Or2b28 C A 13: 21,531,587 (GRCm39) T163K probably damaging Het
Or5an11 T C 19: 12,245,735 (GRCm39) I47T possibly damaging Het
Otogl T A 10: 107,657,894 (GRCm39) probably null Het
Otogl C T 10: 107,737,156 (GRCm39) G86D probably damaging Het
Papln A T 12: 83,838,618 (GRCm39) Q1249L probably benign Het
Plxna2 G T 1: 194,327,202 (GRCm39) G379C probably damaging Het
Pofut2 T C 10: 77,095,260 (GRCm39) I35T probably benign Het
Pros1 A G 16: 62,744,887 (GRCm39) T501A possibly damaging Het
Rapgef1 T C 2: 29,625,821 (GRCm39) S1042P possibly damaging Het
Rps6kb1 C T 11: 86,408,443 (GRCm39) E185K probably damaging Het
Slc13a2 A T 11: 78,294,233 (GRCm39) L216Q probably damaging Het
Slc22a14 T C 9: 119,009,615 (GRCm39) Y160C probably damaging Het
Slc22a4 T A 11: 53,879,773 (GRCm39) I429F possibly damaging Het
Slc26a3 A G 12: 31,511,785 (GRCm39) K457E probably damaging Het
Slc47a2 T C 11: 61,227,060 (GRCm39) I169M possibly damaging Het
Slco1a1 C T 6: 141,854,672 (GRCm39) V660I probably benign Het
Smyd1 A G 6: 71,202,450 (GRCm39) Y252H probably damaging Het
Spp2 A T 1: 88,334,695 (GRCm39) probably benign Het
Stra8 T A 6: 34,911,121 (GRCm39) W250R probably damaging Het
Syne1 A C 10: 5,170,359 (GRCm39) L5183R probably damaging Het
Tdrd9 T C 12: 112,012,684 (GRCm39) S1203P probably damaging Het
Th C A 7: 142,453,620 (GRCm39) E27* probably null Het
Thada C A 17: 84,736,619 (GRCm39) L887F probably damaging Het
Timm23 T C 14: 31,902,586 (GRCm39) T186A probably benign Het
Tmem132b A T 5: 125,860,420 (GRCm39) E555V probably damaging Het
Tnik A T 3: 28,649,093 (GRCm39) Q457L unknown Het
Uba7 C A 9: 107,861,037 (GRCm39) H942Q probably benign Het
Upf2 T C 2: 5,966,078 (GRCm39) S233P unknown Het
Urm1 T A 2: 29,732,760 (GRCm39) N72K probably damaging Het
Usp10 T C 8: 120,675,504 (GRCm39) S508P possibly damaging Het
Usp37 G A 1: 74,499,081 (GRCm39) P632S probably damaging Het
Wdr77 T A 3: 105,872,404 (GRCm39) N209K probably benign Het
Zbtb24 C T 10: 41,327,429 (GRCm39) T105M probably benign Het
Zfp341 T A 2: 154,485,763 (GRCm39) I671N probably damaging Het
Zfp414 A G 17: 33,848,984 (GRCm39) T73A probably benign Het
Zfp574 A T 7: 24,781,404 (GRCm39) I809F possibly damaging Het
Zfp62 T C 11: 49,108,108 (GRCm39) I733T probably damaging Het
Zfp719 A G 7: 43,239,581 (GRCm39) I390V possibly damaging Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75,150,162 (GRCm39) splice site probably benign
IGL00848:Myo5c APN 9 75,196,463 (GRCm39) missense probably benign
IGL01503:Myo5c APN 9 75,170,324 (GRCm39) missense probably damaging 1.00
IGL01735:Myo5c APN 9 75,208,720 (GRCm39) missense probably damaging 1.00
IGL01866:Myo5c APN 9 75,176,864 (GRCm39) missense probably benign 0.00
IGL01956:Myo5c APN 9 75,150,158 (GRCm39) splice site probably null
IGL02127:Myo5c APN 9 75,208,184 (GRCm39) missense probably damaging 1.00
IGL02268:Myo5c APN 9 75,153,519 (GRCm39) missense probably damaging 1.00
IGL02272:Myo5c APN 9 75,173,442 (GRCm39) missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75,159,798 (GRCm39) splice site probably benign
IGL03179:Myo5c APN 9 75,163,148 (GRCm39) missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75,185,525 (GRCm39) missense probably benign 0.01
Marked UTSW 9 75,182,919 (GRCm39) critical splice donor site probably null
pixie UTSW 9 75,193,860 (GRCm39) missense probably benign 0.26
PIT4142001:Myo5c UTSW 9 75,191,230 (GRCm39) missense probably benign 0.00
PIT4431001:Myo5c UTSW 9 75,159,853 (GRCm39) missense possibly damaging 0.75
R0126:Myo5c UTSW 9 75,176,807 (GRCm39) missense probably benign 0.05
R0266:Myo5c UTSW 9 75,191,498 (GRCm39) splice site probably benign
R0345:Myo5c UTSW 9 75,204,701 (GRCm39) missense probably damaging 1.00
R0387:Myo5c UTSW 9 75,192,303 (GRCm39) splice site probably benign
R0602:Myo5c UTSW 9 75,173,478 (GRCm39) splice site probably null
R0675:Myo5c UTSW 9 75,185,571 (GRCm39) missense probably benign
R0798:Myo5c UTSW 9 75,165,266 (GRCm39) missense probably damaging 1.00
R0981:Myo5c UTSW 9 75,178,873 (GRCm39) missense probably damaging 1.00
R1051:Myo5c UTSW 9 75,198,165 (GRCm39) missense probably benign 0.00
R1072:Myo5c UTSW 9 75,199,490 (GRCm39) missense probably damaging 1.00
R1144:Myo5c UTSW 9 75,193,730 (GRCm39) missense probably damaging 1.00
R1454:Myo5c UTSW 9 75,170,348 (GRCm39) missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75,183,221 (GRCm39) missense probably damaging 1.00
R1484:Myo5c UTSW 9 75,208,092 (GRCm39) missense probably damaging 1.00
R1586:Myo5c UTSW 9 75,174,313 (GRCm39) missense probably damaging 0.99
R1616:Myo5c UTSW 9 75,203,299 (GRCm39) missense probably damaging 1.00
R1635:Myo5c UTSW 9 75,184,357 (GRCm39) missense probably benign 0.09
R1800:Myo5c UTSW 9 75,153,446 (GRCm39) missense probably damaging 1.00
R1838:Myo5c UTSW 9 75,180,835 (GRCm39) missense probably damaging 1.00
R1840:Myo5c UTSW 9 75,157,017 (GRCm39) missense probably damaging 1.00
R1885:Myo5c UTSW 9 75,157,043 (GRCm39) missense probably damaging 1.00
R1897:Myo5c UTSW 9 75,199,523 (GRCm39) missense probably benign 0.20
R1898:Myo5c UTSW 9 75,204,908 (GRCm39) missense probably damaging 1.00
R2029:Myo5c UTSW 9 75,196,337 (GRCm39) unclassified probably benign
R2063:Myo5c UTSW 9 75,189,150 (GRCm39) missense probably benign 0.19
R2230:Myo5c UTSW 9 75,180,888 (GRCm39) missense probably benign
R2519:Myo5c UTSW 9 75,157,718 (GRCm39) missense probably damaging 1.00
R2520:Myo5c UTSW 9 75,204,931 (GRCm39) nonsense probably null
R3034:Myo5c UTSW 9 75,193,859 (GRCm39) missense probably benign 0.44
R3117:Myo5c UTSW 9 75,173,476 (GRCm39) critical splice donor site probably null
R3432:Myo5c UTSW 9 75,170,283 (GRCm39) missense probably damaging 1.00
R3751:Myo5c UTSW 9 75,183,284 (GRCm39) missense probably damaging 1.00
R4132:Myo5c UTSW 9 75,159,850 (GRCm39) missense probably benign 0.00
R4173:Myo5c UTSW 9 75,153,540 (GRCm39) missense probably damaging 1.00
R4239:Myo5c UTSW 9 75,191,224 (GRCm39) missense probably benign 0.01
R4429:Myo5c UTSW 9 75,201,283 (GRCm39) missense probably damaging 1.00
R4574:Myo5c UTSW 9 75,176,893 (GRCm39) missense probably benign 0.00
R4791:Myo5c UTSW 9 75,198,198 (GRCm39) missense probably damaging 1.00
R4804:Myo5c UTSW 9 75,152,306 (GRCm39) missense probably damaging 1.00
R4819:Myo5c UTSW 9 75,199,484 (GRCm39) missense probably damaging 0.97
R4881:Myo5c UTSW 9 75,191,434 (GRCm39) missense probably benign 0.00
R4900:Myo5c UTSW 9 75,180,825 (GRCm39) missense probably damaging 1.00
R4964:Myo5c UTSW 9 75,204,791 (GRCm39) missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75,176,878 (GRCm39) missense probably benign 0.03
R5057:Myo5c UTSW 9 75,208,155 (GRCm39) missense probably damaging 1.00
R5347:Myo5c UTSW 9 75,202,487 (GRCm39) missense probably null 1.00
R5399:Myo5c UTSW 9 75,195,356 (GRCm39) missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75,165,407 (GRCm39) missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75,180,792 (GRCm39) missense probably damaging 1.00
R5600:Myo5c UTSW 9 75,196,436 (GRCm39) missense probably benign 0.00
R5606:Myo5c UTSW 9 75,182,790 (GRCm39) missense probably damaging 1.00
R5704:Myo5c UTSW 9 75,180,185 (GRCm39) missense probably benign 0.00
R5798:Myo5c UTSW 9 75,191,480 (GRCm39) missense probably benign 0.04
R5865:Myo5c UTSW 9 75,204,770 (GRCm39) missense probably damaging 0.97
R6034:Myo5c UTSW 9 75,163,187 (GRCm39) missense probably benign 0.05
R6034:Myo5c UTSW 9 75,163,187 (GRCm39) missense probably benign 0.05
R6143:Myo5c UTSW 9 75,157,091 (GRCm39) missense probably damaging 1.00
R6242:Myo5c UTSW 9 75,180,893 (GRCm39) missense probably benign
R6253:Myo5c UTSW 9 75,152,319 (GRCm39) missense probably damaging 1.00
R6264:Myo5c UTSW 9 75,182,836 (GRCm39) missense probably benign
R6307:Myo5c UTSW 9 75,180,198 (GRCm39) missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75,203,294 (GRCm39) missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75,193,860 (GRCm39) missense probably benign 0.26
R6598:Myo5c UTSW 9 75,153,516 (GRCm39) missense probably damaging 1.00
R6618:Myo5c UTSW 9 75,182,919 (GRCm39) critical splice donor site probably null
R6774:Myo5c UTSW 9 75,196,468 (GRCm39) missense probably benign 0.05
R6865:Myo5c UTSW 9 75,176,878 (GRCm39) missense probably benign 0.03
R6996:Myo5c UTSW 9 75,157,746 (GRCm39) missense probably benign 0.01
R7023:Myo5c UTSW 9 75,208,738 (GRCm39) missense probably damaging 0.98
R7123:Myo5c UTSW 9 75,196,505 (GRCm39) missense probably benign
R7250:Myo5c UTSW 9 75,169,497 (GRCm39) missense probably damaging 1.00
R7316:Myo5c UTSW 9 75,176,920 (GRCm39) missense probably benign 0.00
R7340:Myo5c UTSW 9 75,196,423 (GRCm39) missense probably benign
R7382:Myo5c UTSW 9 75,211,332 (GRCm39) missense probably damaging 1.00
R7426:Myo5c UTSW 9 75,158,809 (GRCm39) splice site probably null
R7788:Myo5c UTSW 9 75,186,627 (GRCm39) missense probably damaging 0.98
R7956:Myo5c UTSW 9 75,159,845 (GRCm39) missense probably benign
R8082:Myo5c UTSW 9 75,182,793 (GRCm39) missense possibly damaging 0.89
R8290:Myo5c UTSW 9 75,196,178 (GRCm39) missense probably benign 0.01
R8406:Myo5c UTSW 9 75,182,823 (GRCm39) missense probably damaging 1.00
R8481:Myo5c UTSW 9 75,208,726 (GRCm39) missense probably damaging 1.00
R8489:Myo5c UTSW 9 75,180,128 (GRCm39) missense probably damaging 0.98
R8505:Myo5c UTSW 9 75,153,423 (GRCm39) missense probably damaging 1.00
R8685:Myo5c UTSW 9 75,192,229 (GRCm39) missense possibly damaging 0.66
R8806:Myo5c UTSW 9 75,150,054 (GRCm39) missense probably damaging 1.00
R8871:Myo5c UTSW 9 75,185,585 (GRCm39) missense probably benign 0.10
R9323:Myo5c UTSW 9 75,153,531 (GRCm39) missense probably damaging 1.00
R9639:Myo5c UTSW 9 75,165,477 (GRCm39) missense probably damaging 1.00
Z1088:Myo5c UTSW 9 75,152,341 (GRCm39) missense probably damaging 1.00
Z1177:Myo5c UTSW 9 75,153,537 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATACCCACTGACTATGAGC -3'
(R):5'- AGCATTTCTTCCAGCTGGCC -3'

Sequencing Primer
(F):5'- TGACTATGAGCAAAGACACCTG -3'
(R):5'- ATGCCTTTCCTGCAGGAGC -3'
Posted On 2022-07-18