Incidental Mutation 'R9484:Mypn'
ID 716458
Institutional Source Beutler Lab
Gene Symbol Mypn
Ensembl Gene ENSMUSG00000020067
Gene Name myopalladin
Synonyms 1110056A04Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.184) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 62951574-63039731 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 63003019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 373 (M373L)
Ref Sequence ENSEMBL: ENSMUSP00000093240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095580]
AlphaFold Q5DTJ9
Predicted Effect probably benign
Transcript: ENSMUST00000095580
AA Change: M373L

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093240
Gene: ENSMUSG00000020067
AA Change: M373L

DomainStartEndE-ValueType
low complexity region 46 56 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
IGc2 279 346 2.16e-8 SMART
low complexity region 384 405 N/A INTRINSIC
IGc2 444 519 1.69e-10 SMART
low complexity region 636 648 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 721 741 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 826 838 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
IGc2 953 1022 1.64e-8 SMART
IGc2 1080 1148 3.67e-11 SMART
IG 1173 1259 1.17e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Striated muscle in vertebrates comprises large proteins which must be organized properly to contract efficiently. Z-lines in striated muscle are a sign of this organization, representing the ends of actin thin filaments, titin, nebulin or nebulette and accessory proteins required for structure and function. This gene encodes a protein which interacts with nebulin in skeletal muscle or nebulette in cardiac muscle and alpha-actinin. In addition, this gene product can interact with a protein with the I-band indicating it has a regulatory as well as structural function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(51) : Gene trapped(51)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,250,845 (GRCm39) C151S probably damaging Het
Actr8 T C 14: 29,708,301 (GRCm39) I193T probably benign Het
Btbd2 T C 10: 80,480,103 (GRCm39) N419S probably benign Het
Cacna2d1 T A 5: 16,561,831 (GRCm39) W821R probably damaging Het
Cadps2 T C 6: 23,626,646 (GRCm39) Y214C probably benign Het
Calu T A 6: 29,366,162 (GRCm39) L180Q probably damaging Het
Corin C T 5: 72,497,280 (GRCm39) V615I probably damaging Het
Cyp8b1 A T 9: 121,744,983 (GRCm39) D116E probably benign Het
D630036H23Rik C A 12: 36,431,711 (GRCm39) A96S unknown Het
Ddx24 A T 12: 103,377,555 (GRCm39) Y717N probably damaging Het
Dmap1 G T 4: 117,533,308 (GRCm39) Q249K probably benign Het
Dnah10 T A 5: 124,900,508 (GRCm39) W3922R probably damaging Het
Dnah14 T C 1: 181,517,773 (GRCm39) F2036L probably benign Het
Dnah14 T C 1: 181,625,311 (GRCm39) I4064T probably benign Het
Dock9 A C 14: 121,818,844 (GRCm39) V1546G probably damaging Het
Eif1ad4 A T 12: 87,862,249 (GRCm39) Q37L possibly damaging Het
Eif3a A T 19: 60,755,006 (GRCm39) S1059T unknown Het
Ep300 A G 15: 81,521,026 (GRCm39) E1262G unknown Het
Evl T A 12: 108,652,716 (GRCm39) I387N probably damaging Het
Fat2 A C 11: 55,200,752 (GRCm39) V774G probably damaging Het
Fez1 T A 9: 36,755,093 (GRCm39) Y31N probably benign Het
Fkbp10 A G 11: 100,313,960 (GRCm39) I435V probably damaging Het
Flnb A G 14: 7,929,004 (GRCm38) D1911G probably benign Het
Fnbp1 T C 2: 30,973,038 (GRCm39) Y154C probably benign Het
Fndc10 T C 4: 155,779,496 (GRCm39) I180T possibly damaging Het
Frmd4a G A 2: 4,609,026 (GRCm39) V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 (GRCm39) H64R possibly damaging Het
Glis3 T C 19: 28,508,403 (GRCm39) D527G probably damaging Het
H2-Ob T A 17: 34,459,989 (GRCm39) F33L probably damaging Het
Hbb-bh1 C T 7: 103,492,239 (GRCm39) E27K probably benign Het
Ifnb1 T A 4: 88,440,915 (GRCm39) T33S probably benign Het
Igkv4-80 T A 6: 68,993,766 (GRCm39) T42S probably damaging Het
Irs2 C T 8: 11,057,334 (GRCm39) G366D probably damaging Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,068 (GRCm39) C302S unknown Het
Lgi1 A G 19: 38,294,757 (GRCm39) K510E probably benign Het
Lgi2 T A 5: 52,695,936 (GRCm39) D341V probably benign Het
Lin7c T C 2: 109,724,813 (GRCm39) I14T probably benign Het
Lrrc19 A T 4: 94,531,573 (GRCm39) M13K probably benign Het
Lrrc69 T C 4: 14,666,012 (GRCm39) I315M probably benign Het
Mtcl3 G A 10: 29,072,969 (GRCm39) D754N probably damaging Het
Myo5c A T 9: 75,204,770 (GRCm39) D1541V probably damaging Het
Nckipsd C A 9: 108,689,837 (GRCm39) H333N probably damaging Het
Nrg2 A T 18: 36,157,401 (GRCm39) L428Q probably null Het
Or13a20 T C 7: 140,231,904 (GRCm39) L4S probably benign Het
Or2b28 C A 13: 21,531,587 (GRCm39) T163K probably damaging Het
Or5an11 T C 19: 12,245,735 (GRCm39) I47T possibly damaging Het
Otogl T A 10: 107,657,894 (GRCm39) probably null Het
Otogl C T 10: 107,737,156 (GRCm39) G86D probably damaging Het
Papln A T 12: 83,838,618 (GRCm39) Q1249L probably benign Het
Plxna2 G T 1: 194,327,202 (GRCm39) G379C probably damaging Het
Pofut2 T C 10: 77,095,260 (GRCm39) I35T probably benign Het
Pros1 A G 16: 62,744,887 (GRCm39) T501A possibly damaging Het
Rapgef1 T C 2: 29,625,821 (GRCm39) S1042P possibly damaging Het
Rps6kb1 C T 11: 86,408,443 (GRCm39) E185K probably damaging Het
Slc13a2 A T 11: 78,294,233 (GRCm39) L216Q probably damaging Het
Slc22a14 T C 9: 119,009,615 (GRCm39) Y160C probably damaging Het
Slc22a4 T A 11: 53,879,773 (GRCm39) I429F possibly damaging Het
Slc26a3 A G 12: 31,511,785 (GRCm39) K457E probably damaging Het
Slc47a2 T C 11: 61,227,060 (GRCm39) I169M possibly damaging Het
Slco1a1 C T 6: 141,854,672 (GRCm39) V660I probably benign Het
Smyd1 A G 6: 71,202,450 (GRCm39) Y252H probably damaging Het
Spp2 A T 1: 88,334,695 (GRCm39) probably benign Het
Stra8 T A 6: 34,911,121 (GRCm39) W250R probably damaging Het
Syne1 A C 10: 5,170,359 (GRCm39) L5183R probably damaging Het
Tdrd9 T C 12: 112,012,684 (GRCm39) S1203P probably damaging Het
Th C A 7: 142,453,620 (GRCm39) E27* probably null Het
Thada C A 17: 84,736,619 (GRCm39) L887F probably damaging Het
Timm23 T C 14: 31,902,586 (GRCm39) T186A probably benign Het
Tmem132b A T 5: 125,860,420 (GRCm39) E555V probably damaging Het
Tnik A T 3: 28,649,093 (GRCm39) Q457L unknown Het
Uba7 C A 9: 107,861,037 (GRCm39) H942Q probably benign Het
Upf2 T C 2: 5,966,078 (GRCm39) S233P unknown Het
Urm1 T A 2: 29,732,760 (GRCm39) N72K probably damaging Het
Usp10 T C 8: 120,675,504 (GRCm39) S508P possibly damaging Het
Usp37 G A 1: 74,499,081 (GRCm39) P632S probably damaging Het
Wdr77 T A 3: 105,872,404 (GRCm39) N209K probably benign Het
Zbtb24 C T 10: 41,327,429 (GRCm39) T105M probably benign Het
Zfp341 T A 2: 154,485,763 (GRCm39) I671N probably damaging Het
Zfp414 A G 17: 33,848,984 (GRCm39) T73A probably benign Het
Zfp574 A T 7: 24,781,404 (GRCm39) I809F possibly damaging Het
Zfp62 T C 11: 49,108,108 (GRCm39) I733T probably damaging Het
Zfp719 A G 7: 43,239,581 (GRCm39) I390V possibly damaging Het
Other mutations in Mypn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mypn APN 10 63,028,202 (GRCm39) missense probably damaging 1.00
IGL01137:Mypn APN 10 62,988,633 (GRCm39) missense probably benign 0.12
IGL01383:Mypn APN 10 62,971,576 (GRCm39) missense probably damaging 1.00
IGL01560:Mypn APN 10 62,970,743 (GRCm39) missense probably benign 0.27
IGL01569:Mypn APN 10 62,963,538 (GRCm39) missense probably damaging 1.00
IGL02197:Mypn APN 10 62,959,057 (GRCm39) missense possibly damaging 0.69
IGL02829:Mypn APN 10 63,028,365 (GRCm39) missense probably benign 0.01
IGL03221:Mypn APN 10 62,966,902 (GRCm39) missense probably damaging 1.00
IGL03377:Mypn APN 10 63,028,644 (GRCm39) missense probably benign 0.01
2107:Mypn UTSW 10 63,039,530 (GRCm39) utr 5 prime probably benign
PIT4576001:Mypn UTSW 10 62,955,850 (GRCm39) missense probably damaging 1.00
R0115:Mypn UTSW 10 63,028,159 (GRCm39) splice site probably benign
R0377:Mypn UTSW 10 62,963,401 (GRCm39) unclassified probably benign
R0480:Mypn UTSW 10 63,028,982 (GRCm39) missense probably benign 0.01
R0581:Mypn UTSW 10 62,998,023 (GRCm39) missense probably benign 0.06
R0669:Mypn UTSW 10 62,970,702 (GRCm39) splice site probably benign
R0822:Mypn UTSW 10 63,005,035 (GRCm39) missense probably damaging 1.00
R1209:Mypn UTSW 10 62,954,278 (GRCm39) missense probably damaging 1.00
R1401:Mypn UTSW 10 62,988,636 (GRCm39) missense probably damaging 0.96
R1513:Mypn UTSW 10 63,005,147 (GRCm39) missense probably damaging 0.99
R1750:Mypn UTSW 10 62,971,976 (GRCm39) missense probably benign 0.01
R1780:Mypn UTSW 10 62,957,743 (GRCm39) missense probably damaging 1.00
R1791:Mypn UTSW 10 62,961,472 (GRCm39) missense probably damaging 0.97
R1859:Mypn UTSW 10 62,981,969 (GRCm39) missense probably benign
R1903:Mypn UTSW 10 62,959,176 (GRCm39) missense probably benign 0.06
R2275:Mypn UTSW 10 62,966,848 (GRCm39) missense probably damaging 1.00
R2420:Mypn UTSW 10 63,028,648 (GRCm39) nonsense probably null
R3425:Mypn UTSW 10 62,954,196 (GRCm39) splice site probably benign
R3767:Mypn UTSW 10 62,961,486 (GRCm39) missense possibly damaging 0.88
R3768:Mypn UTSW 10 62,961,486 (GRCm39) missense possibly damaging 0.88
R3770:Mypn UTSW 10 62,961,486 (GRCm39) missense possibly damaging 0.88
R3777:Mypn UTSW 10 62,983,761 (GRCm39) missense possibly damaging 0.92
R3785:Mypn UTSW 10 63,028,961 (GRCm39) missense probably benign 0.43
R3888:Mypn UTSW 10 63,028,289 (GRCm39) missense probably damaging 1.00
R4289:Mypn UTSW 10 62,966,961 (GRCm39) missense probably damaging 1.00
R4301:Mypn UTSW 10 62,954,263 (GRCm39) missense probably damaging 1.00
R4366:Mypn UTSW 10 63,028,487 (GRCm39) missense probably benign 0.00
R4459:Mypn UTSW 10 63,028,211 (GRCm39) missense probably damaging 1.00
R4921:Mypn UTSW 10 62,983,715 (GRCm39) missense possibly damaging 0.75
R4995:Mypn UTSW 10 62,955,747 (GRCm39) splice site probably null
R5064:Mypn UTSW 10 62,959,150 (GRCm39) missense possibly damaging 0.68
R5083:Mypn UTSW 10 62,954,307 (GRCm39) missense probably damaging 0.98
R5108:Mypn UTSW 10 62,972,073 (GRCm39) missense probably damaging 1.00
R5399:Mypn UTSW 10 62,955,965 (GRCm39) missense probably benign 0.03
R5438:Mypn UTSW 10 62,971,618 (GRCm39) nonsense probably null
R5590:Mypn UTSW 10 62,955,827 (GRCm39) missense probably benign 0.27
R5652:Mypn UTSW 10 62,971,580 (GRCm39) missense probably damaging 1.00
R5717:Mypn UTSW 10 62,963,555 (GRCm39) missense probably damaging 1.00
R5970:Mypn UTSW 10 62,966,802 (GRCm39) missense probably benign 0.36
R6616:Mypn UTSW 10 63,005,091 (GRCm39) missense probably damaging 1.00
R6930:Mypn UTSW 10 62,952,718 (GRCm39) missense probably damaging 1.00
R6987:Mypn UTSW 10 63,028,910 (GRCm39) missense probably benign 0.00
R7020:Mypn UTSW 10 63,028,289 (GRCm39) missense probably damaging 1.00
R7081:Mypn UTSW 10 62,970,737 (GRCm39) missense probably damaging 1.00
R7477:Mypn UTSW 10 62,961,500 (GRCm39) missense possibly damaging 0.89
R7534:Mypn UTSW 10 63,028,910 (GRCm39) missense probably benign 0.00
R7853:Mypn UTSW 10 62,981,652 (GRCm39) missense probably benign 0.00
R8367:Mypn UTSW 10 62,971,539 (GRCm39) missense probably damaging 1.00
R8464:Mypn UTSW 10 62,966,977 (GRCm39) nonsense probably null
R8750:Mypn UTSW 10 63,003,036 (GRCm39) missense probably benign 0.00
R8947:Mypn UTSW 10 63,005,156 (GRCm39) missense probably damaging 0.97
R8998:Mypn UTSW 10 62,998,050 (GRCm39) nonsense probably null
R8999:Mypn UTSW 10 62,998,050 (GRCm39) nonsense probably null
R9032:Mypn UTSW 10 62,983,894 (GRCm39) splice site probably null
R9085:Mypn UTSW 10 62,983,894 (GRCm39) splice site probably null
R9130:Mypn UTSW 10 63,028,652 (GRCm39) missense probably benign 0.10
X0022:Mypn UTSW 10 62,971,842 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGGAGTCTTCCCTGAATCC -3'
(R):5'- GTAACACTCACGAGGCTCATGG -3'

Sequencing Primer
(F):5'- CCTGAATCCGCCCATGTATATG -3'
(R):5'- CTTGGCCTCTTCGGGTGAAC -3'
Posted On 2022-07-18