Incidental Mutation 'R9484:Otogl'
ID 716462
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Name otogelin-like
Synonyms Gm6924
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 107596392-107747995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 107737156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 86 (G86D)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
AlphaFold F7A4A7
Predicted Effect probably damaging
Transcript: ENSMUST00000165341
AA Change: G86D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: G86D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,250,845 (GRCm39) C151S probably damaging Het
Actr8 T C 14: 29,708,301 (GRCm39) I193T probably benign Het
Btbd2 T C 10: 80,480,103 (GRCm39) N419S probably benign Het
Cacna2d1 T A 5: 16,561,831 (GRCm39) W821R probably damaging Het
Cadps2 T C 6: 23,626,646 (GRCm39) Y214C probably benign Het
Calu T A 6: 29,366,162 (GRCm39) L180Q probably damaging Het
Corin C T 5: 72,497,280 (GRCm39) V615I probably damaging Het
Cyp8b1 A T 9: 121,744,983 (GRCm39) D116E probably benign Het
D630036H23Rik C A 12: 36,431,711 (GRCm39) A96S unknown Het
Ddx24 A T 12: 103,377,555 (GRCm39) Y717N probably damaging Het
Dmap1 G T 4: 117,533,308 (GRCm39) Q249K probably benign Het
Dnah10 T A 5: 124,900,508 (GRCm39) W3922R probably damaging Het
Dnah14 T C 1: 181,517,773 (GRCm39) F2036L probably benign Het
Dnah14 T C 1: 181,625,311 (GRCm39) I4064T probably benign Het
Dock9 A C 14: 121,818,844 (GRCm39) V1546G probably damaging Het
Eif1ad4 A T 12: 87,862,249 (GRCm39) Q37L possibly damaging Het
Eif3a A T 19: 60,755,006 (GRCm39) S1059T unknown Het
Ep300 A G 15: 81,521,026 (GRCm39) E1262G unknown Het
Evl T A 12: 108,652,716 (GRCm39) I387N probably damaging Het
Fat2 A C 11: 55,200,752 (GRCm39) V774G probably damaging Het
Fez1 T A 9: 36,755,093 (GRCm39) Y31N probably benign Het
Fkbp10 A G 11: 100,313,960 (GRCm39) I435V probably damaging Het
Flnb A G 14: 7,929,004 (GRCm38) D1911G probably benign Het
Fnbp1 T C 2: 30,973,038 (GRCm39) Y154C probably benign Het
Fndc10 T C 4: 155,779,496 (GRCm39) I180T possibly damaging Het
Frmd4a G A 2: 4,609,026 (GRCm39) V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 (GRCm39) H64R possibly damaging Het
Glis3 T C 19: 28,508,403 (GRCm39) D527G probably damaging Het
H2-Ob T A 17: 34,459,989 (GRCm39) F33L probably damaging Het
Hbb-bh1 C T 7: 103,492,239 (GRCm39) E27K probably benign Het
Ifnb1 T A 4: 88,440,915 (GRCm39) T33S probably benign Het
Igkv4-80 T A 6: 68,993,766 (GRCm39) T42S probably damaging Het
Irs2 C T 8: 11,057,334 (GRCm39) G366D probably damaging Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,068 (GRCm39) C302S unknown Het
Lgi1 A G 19: 38,294,757 (GRCm39) K510E probably benign Het
Lgi2 T A 5: 52,695,936 (GRCm39) D341V probably benign Het
Lin7c T C 2: 109,724,813 (GRCm39) I14T probably benign Het
Lrrc19 A T 4: 94,531,573 (GRCm39) M13K probably benign Het
Lrrc69 T C 4: 14,666,012 (GRCm39) I315M probably benign Het
Mtcl3 G A 10: 29,072,969 (GRCm39) D754N probably damaging Het
Myo5c A T 9: 75,204,770 (GRCm39) D1541V probably damaging Het
Mypn T G 10: 63,003,019 (GRCm39) M373L probably benign Het
Nckipsd C A 9: 108,689,837 (GRCm39) H333N probably damaging Het
Nrg2 A T 18: 36,157,401 (GRCm39) L428Q probably null Het
Or13a20 T C 7: 140,231,904 (GRCm39) L4S probably benign Het
Or2b28 C A 13: 21,531,587 (GRCm39) T163K probably damaging Het
Or5an11 T C 19: 12,245,735 (GRCm39) I47T possibly damaging Het
Papln A T 12: 83,838,618 (GRCm39) Q1249L probably benign Het
Plxna2 G T 1: 194,327,202 (GRCm39) G379C probably damaging Het
Pofut2 T C 10: 77,095,260 (GRCm39) I35T probably benign Het
Pros1 A G 16: 62,744,887 (GRCm39) T501A possibly damaging Het
Rapgef1 T C 2: 29,625,821 (GRCm39) S1042P possibly damaging Het
Rps6kb1 C T 11: 86,408,443 (GRCm39) E185K probably damaging Het
Slc13a2 A T 11: 78,294,233 (GRCm39) L216Q probably damaging Het
Slc22a14 T C 9: 119,009,615 (GRCm39) Y160C probably damaging Het
Slc22a4 T A 11: 53,879,773 (GRCm39) I429F possibly damaging Het
Slc26a3 A G 12: 31,511,785 (GRCm39) K457E probably damaging Het
Slc47a2 T C 11: 61,227,060 (GRCm39) I169M possibly damaging Het
Slco1a1 C T 6: 141,854,672 (GRCm39) V660I probably benign Het
Smyd1 A G 6: 71,202,450 (GRCm39) Y252H probably damaging Het
Spp2 A T 1: 88,334,695 (GRCm39) probably benign Het
Stra8 T A 6: 34,911,121 (GRCm39) W250R probably damaging Het
Syne1 A C 10: 5,170,359 (GRCm39) L5183R probably damaging Het
Tdrd9 T C 12: 112,012,684 (GRCm39) S1203P probably damaging Het
Th C A 7: 142,453,620 (GRCm39) E27* probably null Het
Thada C A 17: 84,736,619 (GRCm39) L887F probably damaging Het
Timm23 T C 14: 31,902,586 (GRCm39) T186A probably benign Het
Tmem132b A T 5: 125,860,420 (GRCm39) E555V probably damaging Het
Tnik A T 3: 28,649,093 (GRCm39) Q457L unknown Het
Uba7 C A 9: 107,861,037 (GRCm39) H942Q probably benign Het
Upf2 T C 2: 5,966,078 (GRCm39) S233P unknown Het
Urm1 T A 2: 29,732,760 (GRCm39) N72K probably damaging Het
Usp10 T C 8: 120,675,504 (GRCm39) S508P possibly damaging Het
Usp37 G A 1: 74,499,081 (GRCm39) P632S probably damaging Het
Wdr77 T A 3: 105,872,404 (GRCm39) N209K probably benign Het
Zbtb24 C T 10: 41,327,429 (GRCm39) T105M probably benign Het
Zfp341 T A 2: 154,485,763 (GRCm39) I671N probably damaging Het
Zfp414 A G 17: 33,848,984 (GRCm39) T73A probably benign Het
Zfp574 A T 7: 24,781,404 (GRCm39) I809F possibly damaging Het
Zfp62 T C 11: 49,108,108 (GRCm39) I733T probably damaging Het
Zfp719 A G 7: 43,239,581 (GRCm39) I390V possibly damaging Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107,746,817 (GRCm39) missense probably benign 0.00
R0084:Otogl UTSW 10 107,737,202 (GRCm39) missense probably damaging 0.96
R0164:Otogl UTSW 10 107,710,391 (GRCm39) missense probably damaging 0.97
R0164:Otogl UTSW 10 107,710,391 (GRCm39) missense probably damaging 0.97
R0238:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0238:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0239:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0239:Otogl UTSW 10 107,642,557 (GRCm39) missense probably damaging 0.98
R0294:Otogl UTSW 10 107,613,089 (GRCm39) missense probably damaging 1.00
R0360:Otogl UTSW 10 107,606,511 (GRCm39) splice site probably benign
R0442:Otogl UTSW 10 107,712,716 (GRCm39) missense probably damaging 1.00
R0488:Otogl UTSW 10 107,639,466 (GRCm39) missense probably benign 0.02
R0507:Otogl UTSW 10 107,702,601 (GRCm39) missense possibly damaging 0.51
R0573:Otogl UTSW 10 107,616,849 (GRCm39) missense probably benign 0.00
R0581:Otogl UTSW 10 107,624,901 (GRCm39) missense possibly damaging 0.79
R0613:Otogl UTSW 10 107,652,931 (GRCm39) missense probably damaging 0.99
R0614:Otogl UTSW 10 107,634,216 (GRCm39) missense probably benign 0.14
R0742:Otogl UTSW 10 107,702,601 (GRCm39) missense possibly damaging 0.51
R0846:Otogl UTSW 10 107,608,157 (GRCm39) missense probably benign 0.40
R1146:Otogl UTSW 10 107,722,374 (GRCm39) missense probably damaging 1.00
R1146:Otogl UTSW 10 107,722,374 (GRCm39) missense probably damaging 1.00
R1439:Otogl UTSW 10 107,615,113 (GRCm39) missense probably benign 0.02
R1457:Otogl UTSW 10 107,714,013 (GRCm39) splice site probably null
R1526:Otogl UTSW 10 107,705,387 (GRCm39) missense probably damaging 1.00
R1662:Otogl UTSW 10 107,634,218 (GRCm39) missense possibly damaging 0.84
R1664:Otogl UTSW 10 107,642,437 (GRCm39) missense probably benign 0.00
R1667:Otogl UTSW 10 107,649,826 (GRCm39) nonsense probably null
R1695:Otogl UTSW 10 107,649,878 (GRCm39) missense probably damaging 0.99
R1731:Otogl UTSW 10 107,652,972 (GRCm39) missense probably damaging 1.00
R1733:Otogl UTSW 10 107,619,573 (GRCm39) missense possibly damaging 0.46
R1764:Otogl UTSW 10 107,735,322 (GRCm39) nonsense probably null
R1824:Otogl UTSW 10 107,615,692 (GRCm39) missense probably benign
R1850:Otogl UTSW 10 107,713,925 (GRCm39) missense probably damaging 1.00
R1856:Otogl UTSW 10 107,690,125 (GRCm39) missense possibly damaging 0.92
R1875:Otogl UTSW 10 107,735,451 (GRCm39) missense probably damaging 1.00
R1938:Otogl UTSW 10 107,613,436 (GRCm39) missense probably damaging 0.98
R1986:Otogl UTSW 10 107,630,051 (GRCm39) critical splice acceptor site probably null
R2072:Otogl UTSW 10 107,616,904 (GRCm39) missense probably damaging 1.00
R2117:Otogl UTSW 10 107,694,779 (GRCm39) missense probably benign 0.06
R2219:Otogl UTSW 10 107,692,838 (GRCm39) missense probably damaging 1.00
R2508:Otogl UTSW 10 107,710,361 (GRCm39) missense probably damaging 0.99
R2883:Otogl UTSW 10 107,604,842 (GRCm39) missense probably damaging 1.00
R2931:Otogl UTSW 10 107,655,865 (GRCm39) missense possibly damaging 0.85
R3620:Otogl UTSW 10 107,710,232 (GRCm39) missense probably damaging 0.99
R3621:Otogl UTSW 10 107,710,232 (GRCm39) missense probably damaging 0.99
R3735:Otogl UTSW 10 107,735,390 (GRCm39) nonsense probably null
R3812:Otogl UTSW 10 107,735,332 (GRCm39) missense probably damaging 1.00
R3880:Otogl UTSW 10 107,663,565 (GRCm39) missense probably damaging 0.96
R3958:Otogl UTSW 10 107,657,786 (GRCm39) missense probably damaging 1.00
R4063:Otogl UTSW 10 107,626,510 (GRCm39) missense probably benign 0.02
R4064:Otogl UTSW 10 107,626,510 (GRCm39) missense probably benign 0.02
R4108:Otogl UTSW 10 107,607,105 (GRCm39) missense probably benign 0.01
R4352:Otogl UTSW 10 107,705,396 (GRCm39) missense probably damaging 1.00
R4526:Otogl UTSW 10 107,722,841 (GRCm39) missense probably damaging 1.00
R4614:Otogl UTSW 10 107,727,985 (GRCm39) nonsense probably null
R4703:Otogl UTSW 10 107,657,785 (GRCm39) missense probably damaging 1.00
R4741:Otogl UTSW 10 107,615,121 (GRCm39) missense probably benign 0.00
R4790:Otogl UTSW 10 107,657,894 (GRCm39) critical splice acceptor site probably null
R4801:Otogl UTSW 10 107,737,197 (GRCm39) missense probably damaging 1.00
R4802:Otogl UTSW 10 107,737,197 (GRCm39) missense probably damaging 1.00
R4910:Otogl UTSW 10 107,715,378 (GRCm39) missense probably benign 0.05
R4913:Otogl UTSW 10 107,712,716 (GRCm39) missense probably damaging 0.98
R5238:Otogl UTSW 10 107,604,834 (GRCm39) missense probably damaging 1.00
R5261:Otogl UTSW 10 107,613,453 (GRCm39) missense probably benign 0.16
R5387:Otogl UTSW 10 107,616,794 (GRCm39) missense probably benign 0.03
R5395:Otogl UTSW 10 107,652,999 (GRCm39) missense probably benign 0.39
R5403:Otogl UTSW 10 107,644,617 (GRCm39) missense probably benign 0.08
R5482:Otogl UTSW 10 107,657,802 (GRCm39) missense probably damaging 0.99
R5547:Otogl UTSW 10 107,617,909 (GRCm39) missense possibly damaging 0.55
R5611:Otogl UTSW 10 107,622,630 (GRCm39) missense probably damaging 1.00
R5642:Otogl UTSW 10 107,722,413 (GRCm39) missense probably benign 0.44
R5690:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5711:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5731:Otogl UTSW 10 107,717,325 (GRCm39) missense probably damaging 0.98
R5743:Otogl UTSW 10 107,692,862 (GRCm39) missense possibly damaging 0.67
R5782:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5820:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R5897:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6004:Otogl UTSW 10 107,715,390 (GRCm39) missense probably damaging 1.00
R6145:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6146:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6147:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6149:Otogl UTSW 10 107,717,314 (GRCm39) missense probably benign 0.36
R6226:Otogl UTSW 10 107,607,067 (GRCm39) nonsense probably null
R6283:Otogl UTSW 10 107,626,361 (GRCm39) missense probably damaging 0.98
R6414:Otogl UTSW 10 107,617,911 (GRCm39) missense probably damaging 1.00
R6604:Otogl UTSW 10 107,657,895 (GRCm39) splice site probably null
R6634:Otogl UTSW 10 107,698,165 (GRCm39) missense probably damaging 1.00
R6727:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6755:Otogl UTSW 10 107,689,164 (GRCm39) nonsense probably null
R6795:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6797:Otogl UTSW 10 107,612,978 (GRCm39) synonymous silent
R6864:Otogl UTSW 10 107,663,667 (GRCm39) missense probably damaging 0.96
R6924:Otogl UTSW 10 107,644,502 (GRCm39) missense probably damaging 1.00
R6967:Otogl UTSW 10 107,649,911 (GRCm39) missense probably benign 0.01
R7000:Otogl UTSW 10 107,615,692 (GRCm39) missense probably benign
R7075:Otogl UTSW 10 107,614,790 (GRCm39) missense probably benign 0.16
R7122:Otogl UTSW 10 107,702,515 (GRCm39) missense probably benign 0.08
R7176:Otogl UTSW 10 107,614,772 (GRCm39) missense probably damaging 1.00
R7184:Otogl UTSW 10 107,599,061 (GRCm39) missense probably damaging 1.00
R7199:Otogl UTSW 10 107,710,394 (GRCm39) missense possibly damaging 0.88
R7252:Otogl UTSW 10 107,657,804 (GRCm39) missense probably benign 0.06
R7286:Otogl UTSW 10 107,606,471 (GRCm39) missense probably benign 0.00
R7373:Otogl UTSW 10 107,737,112 (GRCm39) missense probably damaging 1.00
R7449:Otogl UTSW 10 107,639,524 (GRCm39) missense probably damaging 1.00
R7486:Otogl UTSW 10 107,657,849 (GRCm39) missense probably damaging 1.00
R7493:Otogl UTSW 10 107,722,843 (GRCm39) missense probably benign 0.06
R7659:Otogl UTSW 10 107,612,981 (GRCm39) missense probably benign 0.19
R7732:Otogl UTSW 10 107,642,525 (GRCm39) missense probably benign 0.01
R7754:Otogl UTSW 10 107,705,407 (GRCm39) missense probably damaging 0.99
R7757:Otogl UTSW 10 107,712,782 (GRCm39) missense probably damaging 1.00
R7800:Otogl UTSW 10 107,722,376 (GRCm39) missense probably damaging 0.99
R7864:Otogl UTSW 10 107,705,428 (GRCm39) missense probably damaging 1.00
R7879:Otogl UTSW 10 107,612,970 (GRCm39) missense probably benign 0.00
R7941:Otogl UTSW 10 107,642,663 (GRCm39) splice site probably null
R7956:Otogl UTSW 10 107,713,887 (GRCm39) missense possibly damaging 0.62
R7988:Otogl UTSW 10 107,731,637 (GRCm39) missense probably damaging 1.00
R8057:Otogl UTSW 10 107,644,476 (GRCm39) missense probably benign 0.00
R8058:Otogl UTSW 10 107,598,287 (GRCm39) missense probably damaging 1.00
R8127:Otogl UTSW 10 107,731,613 (GRCm39) missense probably damaging 1.00
R8143:Otogl UTSW 10 107,642,527 (GRCm39) missense probably damaging 1.00
R8310:Otogl UTSW 10 107,613,461 (GRCm39) missense possibly damaging 0.94
R8319:Otogl UTSW 10 107,689,127 (GRCm39) critical splice donor site probably null
R8339:Otogl UTSW 10 107,625,397 (GRCm39) missense probably benign 0.34
R8339:Otogl UTSW 10 107,625,396 (GRCm39) missense probably damaging 0.99
R8394:Otogl UTSW 10 107,722,326 (GRCm39) critical splice donor site probably null
R8428:Otogl UTSW 10 107,634,597 (GRCm39) missense probably damaging 1.00
R8444:Otogl UTSW 10 107,692,975 (GRCm39) missense probably benign 0.01
R8501:Otogl UTSW 10 107,626,421 (GRCm39) missense probably benign
R8503:Otogl UTSW 10 107,727,987 (GRCm39) missense probably damaging 1.00
R8680:Otogl UTSW 10 107,747,936 (GRCm39) critical splice donor site probably null
R9025:Otogl UTSW 10 107,613,432 (GRCm39) missense probably damaging 0.99
R9090:Otogl UTSW 10 107,652,974 (GRCm39) missense probably null 0.99
R9223:Otogl UTSW 10 107,690,205 (GRCm39) missense probably damaging 0.99
R9268:Otogl UTSW 10 107,616,917 (GRCm39) missense probably damaging 1.00
R9271:Otogl UTSW 10 107,652,974 (GRCm39) missense probably null 0.99
R9356:Otogl UTSW 10 107,617,890 (GRCm39) missense probably damaging 1.00
R9484:Otogl UTSW 10 107,657,894 (GRCm39) critical splice acceptor site probably null
R9571:Otogl UTSW 10 107,598,364 (GRCm39) missense possibly damaging 0.94
R9731:Otogl UTSW 10 107,735,328 (GRCm39) missense probably damaging 1.00
X0065:Otogl UTSW 10 107,731,643 (GRCm39) missense probably damaging 1.00
X0067:Otogl UTSW 10 107,702,538 (GRCm39) missense probably damaging 1.00
Z1176:Otogl UTSW 10 107,614,734 (GRCm39) missense probably damaging 0.97
Z1176:Otogl UTSW 10 107,613,074 (GRCm39) missense probably benign
Z1176:Otogl UTSW 10 107,624,893 (GRCm39) missense probably benign 0.00
Z1177:Otogl UTSW 10 107,689,258 (GRCm39) missense possibly damaging 0.78
Z1177:Otogl UTSW 10 107,599,119 (GRCm39) nonsense probably null
Z1177:Otogl UTSW 10 107,712,764 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GACGGTTCTACTAAGCTAATGCC -3'
(R):5'- AGGCCCAGGTTCTGTTTAAG -3'

Sequencing Primer
(F):5'- CAGTGTTTCTACATCACTTCAAATGG -3'
(R):5'- AGGCCCAGGTTCTGTTTAAGTTAAC -3'
Posted On 2022-07-18