Incidental Mutation 'R9484:Fat2'
ID 716465
Institutional Source Beutler Lab
Gene Symbol Fat2
Ensembl Gene ENSMUSG00000055333
Gene Name FAT atypical cadherin 2
Synonyms mKIAA0811, LOC245827, Fath2, EMI2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 55250609-55336564 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 55309926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 774 (V774G)
Ref Sequence ENSEMBL: ENSMUSP00000067556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068853] [ENSMUST00000108864]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068853
AA Change: V774G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067556
Gene: ENSMUSG00000055333
AA Change: V774G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108864
AA Change: V774G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104492
Gene: ENSMUSG00000055333
AA Change: V774G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the second identified human homolog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has two epidermal growth factor (EGF)-like repeats and one laminin G domain. This protein most likely functions as a cell adhesion molecule, controlling cell proliferation and playing an important role in cerebellum development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy, fertile and overtly normal, with no apparent defects in the development of red blood cells or platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,112,786 C151S probably damaging Het
Actr8 T C 14: 29,986,344 I193T probably benign Het
Btbd2 T C 10: 80,644,269 N419S probably benign Het
Cacna2d1 T A 5: 16,356,833 W821R probably damaging Het
Cadps2 T C 6: 23,626,647 Y214C probably benign Het
Calu T A 6: 29,366,163 L180Q probably damaging Het
Corin C T 5: 72,339,937 V615I probably damaging Het
Cyp8b1 A T 9: 121,915,917 D116E probably benign Het
D630036H23Rik C A 12: 36,381,712 A96S unknown Het
Ddx24 A T 12: 103,411,296 Y717N probably damaging Het
Dmap1 G T 4: 117,676,111 Q249K probably benign Het
Dnah10 T A 5: 124,823,444 W3922R probably damaging Het
Dnah14 T C 1: 181,690,208 F2036L probably benign Het
Dnah14 T C 1: 181,797,746 I4064T probably benign Het
Dock9 A C 14: 121,581,432 V1546G probably damaging Het
Eif3a A T 19: 60,766,568 S1059T unknown Het
Ep300 A G 15: 81,636,825 E1262G unknown Het
Evl T A 12: 108,686,457 I387N probably damaging Het
Fez1 T A 9: 36,843,797 Y31N probably benign Het
Fkbp10 A G 11: 100,423,134 I435V probably damaging Het
Flnb A G 14: 7,929,004 D1911G probably benign Het
Fnbp1 T C 2: 31,083,026 Y154C probably benign Het
Fndc10 T C 4: 155,695,039 I180T possibly damaging Het
Frmd4a G A 2: 4,604,215 V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 H64R possibly damaging Het
Glis3 T C 19: 28,531,003 D527G probably damaging Het
Gm2022 A T 12: 87,895,479 Q37L possibly damaging Het
H2-Ob T A 17: 34,241,015 F33L probably damaging Het
Hbb-bh1 C T 7: 103,843,032 E27K probably benign Het
Ifnb1 T A 4: 88,522,678 T33S probably benign Het
Igkv4-80 T A 6: 69,016,782 T42S probably damaging Het
Irs2 C T 8: 11,007,334 G366D probably damaging Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Krtap5-3 T A 7: 142,202,331 C302S unknown Het
Lgi1 A G 19: 38,306,309 K510E probably benign Het
Lgi2 T A 5: 52,538,594 D341V probably benign Het
Lin7c T C 2: 109,894,468 I14T probably benign Het
Lrrc19 A T 4: 94,643,336 M13K probably benign Het
Lrrc69 T C 4: 14,666,012 I315M probably benign Het
Myo5c A T 9: 75,297,488 D1541V probably damaging Het
Mypn T G 10: 63,167,240 M373L probably benign Het
Nckipsd C A 9: 108,812,638 H333N probably damaging Het
Nrg2 A T 18: 36,024,348 L428Q probably null Het
Olfr1367 C A 13: 21,347,417 T163K probably damaging Het
Olfr235 T C 19: 12,268,371 I47T possibly damaging Het
Olfr53 T C 7: 140,651,991 L4S probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otogl C T 10: 107,901,295 G86D probably damaging Het
Papln A T 12: 83,791,844 Q1249L probably benign Het
Plxna2 G T 1: 194,644,894 G379C probably damaging Het
Pofut2 T C 10: 77,259,426 I35T probably benign Het
Pros1 A G 16: 62,924,524 T501A possibly damaging Het
Rapgef1 T C 2: 29,735,809 S1042P possibly damaging Het
Rps6kb1 C T 11: 86,517,617 E185K probably damaging Het
Slc13a2 A T 11: 78,403,407 L216Q probably damaging Het
Slc22a14 T C 9: 119,180,549 Y160C probably damaging Het
Slc22a4 T A 11: 53,988,947 I429F possibly damaging Het
Slc26a3 A G 12: 31,461,786 K457E probably damaging Het
Slc47a2 T C 11: 61,336,234 I169M possibly damaging Het
Slco1a1 C T 6: 141,908,946 V660I probably benign Het
Smyd1 A G 6: 71,225,466 Y252H probably damaging Het
Soga3 G A 10: 29,196,973 D754N probably damaging Het
Spp2 A T 1: 88,406,973 probably benign Het
Stra8 T A 6: 34,934,186 W250R probably damaging Het
Syne1 A C 10: 5,220,359 L5183R probably damaging Het
Tdrd9 T C 12: 112,046,250 S1203P probably damaging Het
Th C A 7: 142,899,883 E27* probably null Het
Thada C A 17: 84,429,191 L887F probably damaging Het
Timm23 T C 14: 32,180,629 T186A probably benign Het
Tmem132b A T 5: 125,783,356 E555V probably damaging Het
Tnik A T 3: 28,594,944 Q457L unknown Het
Uba7 C A 9: 107,983,838 H942Q probably benign Het
Upf2 T C 2: 5,961,267 S233P unknown Het
Urm1 T A 2: 29,842,748 N72K probably damaging Het
Usp10 T C 8: 119,948,765 S508P possibly damaging Het
Usp37 G A 1: 74,459,922 P632S probably damaging Het
Wdr77 T A 3: 105,965,088 N209K probably benign Het
Zbtb24 C T 10: 41,451,433 T105M probably benign Het
Zfp341 T A 2: 154,643,843 I671N probably damaging Het
Zfp414 A G 17: 33,630,010 T73A probably benign Het
Zfp574 A T 7: 25,081,979 I809F possibly damaging Het
Zfp62 T C 11: 49,217,281 I733T probably damaging Het
Zfp719 A G 7: 43,590,157 I390V possibly damaging Het
Other mutations in Fat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Fat2 APN 11 55311244 missense probably benign
IGL00897:Fat2 APN 11 55289252 missense probably damaging 0.99
IGL01161:Fat2 APN 11 55284191 missense probably benign
IGL01306:Fat2 APN 11 55310872 missense probably benign 0.28
IGL01393:Fat2 APN 11 55269309 missense probably benign 0.00
IGL01529:Fat2 APN 11 55282156 missense probably damaging 1.00
IGL01530:Fat2 APN 11 55283387 missense probably benign 0.42
IGL01555:Fat2 APN 11 55278930 missense probably damaging 0.99
IGL01758:Fat2 APN 11 55296209 missense probably damaging 1.00
IGL01768:Fat2 APN 11 55262568 missense probably damaging 1.00
IGL01939:Fat2 APN 11 55283980 missense probably benign 0.01
IGL01941:Fat2 APN 11 55312005 missense probably benign 0.01
IGL01967:Fat2 APN 11 55311823 missense probably damaging 1.00
IGL01978:Fat2 APN 11 55270146 missense probably benign 0.34
IGL01998:Fat2 APN 11 55296195 missense probably benign 0.00
IGL02001:Fat2 APN 11 55312245 start codon destroyed probably null 0.89
IGL02004:Fat2 APN 11 55282840 missense probably damaging 1.00
IGL02103:Fat2 APN 11 55289296 missense probably damaging 0.96
IGL02131:Fat2 APN 11 55309042 missense probably damaging 1.00
IGL02155:Fat2 APN 11 55262419 missense probably benign 0.00
IGL02223:Fat2 APN 11 55273129 missense probably benign 0.01
IGL02231:Fat2 APN 11 55281092 missense probably damaging 0.98
IGL02312:Fat2 APN 11 55270259 missense probably damaging 1.00
IGL02476:Fat2 APN 11 55311124 missense probably damaging 1.00
IGL02539:Fat2 APN 11 55281793 missense probably damaging 1.00
IGL02553:Fat2 APN 11 55311283 missense probably damaging 1.00
IGL02645:Fat2 APN 11 55282828 missense probably damaging 1.00
IGL02664:Fat2 APN 11 55311096 missense probably damaging 1.00
IGL02708:Fat2 APN 11 55282385 missense probably damaging 0.99
IGL02883:Fat2 APN 11 55256618 missense probably benign 0.16
IGL02894:Fat2 APN 11 55256653 missense probably damaging 1.00
IGL02975:Fat2 APN 11 55270194 missense probably benign 0.00
IGL03085:Fat2 APN 11 55283246 missense probably benign 0.09
IGL03106:Fat2 APN 11 55311901 missense probably benign 0.45
IGL03132:Fat2 APN 11 55253920 missense probably benign 0.25
IGL03133:Fat2 APN 11 55286043 missense probably benign 0.01
IGL03194:Fat2 APN 11 55310995 missense probably benign 0.02
IGL03266:Fat2 APN 11 55284029 missense possibly damaging 0.62
IGL03290:Fat2 APN 11 55256219 missense probably benign 0.33
IGL03291:Fat2 APN 11 55262595 missense probably benign
IGL03325:Fat2 APN 11 55282342 missense probably damaging 1.00
IGL03345:Fat2 APN 11 55282361 missense probably damaging 1.00
IGL03371:Fat2 APN 11 55311164 missense probably benign 0.10
ANU23:Fat2 UTSW 11 55310872 missense probably benign 0.28
BB001:Fat2 UTSW 11 55262787 missense probably benign 0.03
BB011:Fat2 UTSW 11 55262787 missense probably benign 0.03
P0040:Fat2 UTSW 11 55282213 missense possibly damaging 0.89
PIT4504001:Fat2 UTSW 11 55256110 missense possibly damaging 0.68
R0008:Fat2 UTSW 11 55311249 missense probably damaging 1.00
R0008:Fat2 UTSW 11 55311249 missense probably damaging 1.00
R0012:Fat2 UTSW 11 55262871 missense probably benign 0.16
R0012:Fat2 UTSW 11 55262871 missense probably benign 0.16
R0048:Fat2 UTSW 11 55310039 missense probably benign 0.00
R0048:Fat2 UTSW 11 55310039 missense probably benign 0.00
R0098:Fat2 UTSW 11 55298605 missense probably damaging 0.98
R0124:Fat2 UTSW 11 55283678 missense probably damaging 0.98
R0127:Fat2 UTSW 11 55289286 missense probably benign 0.01
R0130:Fat2 UTSW 11 55252118 missense probably benign 0.26
R0131:Fat2 UTSW 11 55273211 missense probably benign
R0158:Fat2 UTSW 11 55296185 missense probably benign 0.00
R0184:Fat2 UTSW 11 55296288 missense probably damaging 1.00
R0367:Fat2 UTSW 11 55292093 splice site probably benign
R0384:Fat2 UTSW 11 55269465 missense possibly damaging 0.81
R0390:Fat2 UTSW 11 55310777 missense probably damaging 0.99
R0403:Fat2 UTSW 11 55270349 missense probably benign 0.42
R0416:Fat2 UTSW 11 55284134 missense possibly damaging 0.94
R0437:Fat2 UTSW 11 55282799 missense probably benign 0.02
R0463:Fat2 UTSW 11 55262829 missense probably damaging 1.00
R0497:Fat2 UTSW 11 55283402 missense probably benign 0.03
R0617:Fat2 UTSW 11 55311843 missense possibly damaging 0.60
R0622:Fat2 UTSW 11 55283128 missense probably damaging 1.00
R0675:Fat2 UTSW 11 55309209 missense probably damaging 0.97
R0811:Fat2 UTSW 11 55253633 missense possibly damaging 0.75
R0812:Fat2 UTSW 11 55253633 missense possibly damaging 0.75
R0869:Fat2 UTSW 11 55311775 missense probably benign 0.08
R0870:Fat2 UTSW 11 55311775 missense probably benign 0.08
R0899:Fat2 UTSW 11 55256225 missense probably damaging 1.00
R1278:Fat2 UTSW 11 55268179 missense probably damaging 1.00
R1383:Fat2 UTSW 11 55310773 missense probably benign
R1428:Fat2 UTSW 11 55296087 missense probably damaging 1.00
R1438:Fat2 UTSW 11 55287811 missense probably damaging 1.00
R1495:Fat2 UTSW 11 55262673 missense probably benign
R1506:Fat2 UTSW 11 55284264 missense probably benign
R1547:Fat2 UTSW 11 55252255 missense probably benign 0.01
R1554:Fat2 UTSW 11 55253664 missense probably benign 0.01
R1562:Fat2 UTSW 11 55309974 missense probably damaging 1.00
R1588:Fat2 UTSW 11 55283404 missense probably damaging 1.00
R1592:Fat2 UTSW 11 55291870 splice site probably null
R1601:Fat2 UTSW 11 55282010 missense probably benign 0.01
R1610:Fat2 UTSW 11 55278924 missense probably damaging 1.00
R1634:Fat2 UTSW 11 55267684 missense probably damaging 1.00
R1634:Fat2 UTSW 11 55284719 missense probably benign
R1644:Fat2 UTSW 11 55287783 missense possibly damaging 0.91
R1644:Fat2 UTSW 11 55296181 missense possibly damaging 0.94
R1691:Fat2 UTSW 11 55311852 missense probably damaging 0.99
R1734:Fat2 UTSW 11 55281371 missense probably benign 0.00
R1748:Fat2 UTSW 11 55256647 missense probably damaging 0.97
R1771:Fat2 UTSW 11 55310865 missense probably benign 0.01
R1800:Fat2 UTSW 11 55283892 missense probably damaging 1.00
R1807:Fat2 UTSW 11 55289259 missense probably damaging 1.00
R1823:Fat2 UTSW 11 55256780 missense probably benign 0.29
R1848:Fat2 UTSW 11 55311558 missense probably damaging 1.00
R1866:Fat2 UTSW 11 55292014 missense probably benign 0.00
R1899:Fat2 UTSW 11 55262178 missense probably benign
R1954:Fat2 UTSW 11 55311084 missense probably benign 0.06
R2010:Fat2 UTSW 11 55253827 missense probably damaging 0.99
R2011:Fat2 UTSW 11 55282757 missense probably damaging 1.00
R2057:Fat2 UTSW 11 55281860 missense possibly damaging 0.60
R2081:Fat2 UTSW 11 55309677 missense possibly damaging 0.94
R2106:Fat2 UTSW 11 55256564 missense probably benign 0.00
R2165:Fat2 UTSW 11 55303716 missense probably benign 0.00
R2176:Fat2 UTSW 11 55267575 critical splice donor site probably null
R2284:Fat2 UTSW 11 55282360 missense probably damaging 1.00
R2338:Fat2 UTSW 11 55311901 missense possibly damaging 0.93
R2340:Fat2 UTSW 11 55270096 missense possibly damaging 0.90
R2427:Fat2 UTSW 11 55310812 missense probably benign 0.15
R2444:Fat2 UTSW 11 55281973 missense probably damaging 1.00
R2858:Fat2 UTSW 11 55283773 missense possibly damaging 0.94
R2882:Fat2 UTSW 11 55311305 missense probably damaging 0.96
R3029:Fat2 UTSW 11 55284709 missense probably damaging 1.00
R3085:Fat2 UTSW 11 55252171 missense possibly damaging 0.79
R3121:Fat2 UTSW 11 55311796 missense probably damaging 1.00
R3418:Fat2 UTSW 11 55278998 missense probably benign 0.01
R3500:Fat2 UTSW 11 55260516 missense probably damaging 0.99
R3607:Fat2 UTSW 11 55281685 missense probably damaging 1.00
R3611:Fat2 UTSW 11 55312069 missense probably benign
R3620:Fat2 UTSW 11 55256695 missense probably damaging 0.97
R3688:Fat2 UTSW 11 55281101 missense probably damaging 0.99
R3704:Fat2 UTSW 11 55309650 missense probably damaging 1.00
R3784:Fat2 UTSW 11 55256186 missense probably benign
R3889:Fat2 UTSW 11 55281763 missense probably damaging 1.00
R3951:Fat2 UTSW 11 55296382 missense probably benign 0.00
R4211:Fat2 UTSW 11 55283984 missense probably damaging 1.00
R4249:Fat2 UTSW 11 55284301 missense probably damaging 0.98
R4406:Fat2 UTSW 11 55262268 missense probably benign 0.00
R4433:Fat2 UTSW 11 55309640 missense possibly damaging 0.91
R4436:Fat2 UTSW 11 55296198 missense probably damaging 1.00
R4498:Fat2 UTSW 11 55270097 missense possibly damaging 0.90
R4560:Fat2 UTSW 11 55265951 missense possibly damaging 0.89
R4594:Fat2 UTSW 11 55284752 missense possibly damaging 0.78
R4663:Fat2 UTSW 11 55296213 nonsense probably null
R4669:Fat2 UTSW 11 55311615 missense probably benign 0.01
R4696:Fat2 UTSW 11 55285015 missense probably benign 0.00
R4734:Fat2 UTSW 11 55311468 missense probably benign 0.01
R4749:Fat2 UTSW 11 55311468 missense probably benign 0.01
R4765:Fat2 UTSW 11 55281187 missense probably damaging 1.00
R4803:Fat2 UTSW 11 55285060 missense probably benign 0.03
R4805:Fat2 UTSW 11 55283979 missense probably benign 0.01
R4822:Fat2 UTSW 11 55311318 missense probably benign 0.02
R4840:Fat2 UTSW 11 55279018 missense probably benign 0.21
R4849:Fat2 UTSW 11 55310637 missense probably damaging 1.00
R4943:Fat2 UTSW 11 55279033 missense probably benign 0.00
R4993:Fat2 UTSW 11 55283092 missense probably damaging 0.99
R5097:Fat2 UTSW 11 55310704 missense probably damaging 1.00
R5104:Fat2 UTSW 11 55278988 missense possibly damaging 0.93
R5115:Fat2 UTSW 11 55296333 missense probably damaging 1.00
R5213:Fat2 UTSW 11 55253832 missense probably benign 0.00
R5254:Fat2 UTSW 11 55281175 missense probably damaging 1.00
R5269:Fat2 UTSW 11 55287878 missense probably benign 0.00
R5288:Fat2 UTSW 11 55267656 missense probably benign 0.00
R5355:Fat2 UTSW 11 55282166 missense probably damaging 1.00
R5375:Fat2 UTSW 11 55262820 missense probably benign 0.00
R5379:Fat2 UTSW 11 55303941 missense probably damaging 0.99
R5411:Fat2 UTSW 11 55252226 missense probably benign 0.23
R5416:Fat2 UTSW 11 55303688 missense possibly damaging 0.77
R5480:Fat2 UTSW 11 55310086 missense probably damaging 0.99
R5486:Fat2 UTSW 11 55253681 missense probably benign 0.00
R5526:Fat2 UTSW 11 55269361 missense possibly damaging 0.90
R5532:Fat2 UTSW 11 55262337 missense probably damaging 1.00
R5583:Fat2 UTSW 11 55253889 missense probably benign 0.00
R5588:Fat2 UTSW 11 55282277 missense probably damaging 1.00
R5598:Fat2 UTSW 11 55281130 missense probably damaging 1.00
R5636:Fat2 UTSW 11 55282481 missense probably damaging 1.00
R5653:Fat2 UTSW 11 55310316 missense probably damaging 1.00
R5657:Fat2 UTSW 11 55310681 nonsense probably null
R5660:Fat2 UTSW 11 55284176 missense probably benign 0.00
R5752:Fat2 UTSW 11 55289237 missense possibly damaging 0.48
R5757:Fat2 UTSW 11 55252346 missense probably damaging 1.00
R5792:Fat2 UTSW 11 55262325 missense possibly damaging 0.77
R5872:Fat2 UTSW 11 55270382 missense probably damaging 1.00
R5933:Fat2 UTSW 11 55284051 missense probably damaging 1.00
R6030:Fat2 UTSW 11 55310303 nonsense probably null
R6030:Fat2 UTSW 11 55310303 nonsense probably null
R6032:Fat2 UTSW 11 55253934 missense probably damaging 1.00
R6032:Fat2 UTSW 11 55253934 missense probably damaging 1.00
R6221:Fat2 UTSW 11 55296072 critical splice donor site probably null
R6253:Fat2 UTSW 11 55296271 missense probably damaging 1.00
R6257:Fat2 UTSW 11 55262581 missense probably benign
R6307:Fat2 UTSW 11 55281280 missense possibly damaging 0.63
R6450:Fat2 UTSW 11 55289310 missense probably damaging 0.97
R6453:Fat2 UTSW 11 55282216 missense probably benign 0.29
R6455:Fat2 UTSW 11 55270457 missense probably damaging 0.96
R6483:Fat2 UTSW 11 55296345 missense probably damaging 1.00
R6504:Fat2 UTSW 11 55262397 missense probably benign 0.00
R6520:Fat2 UTSW 11 55284988 missense probably damaging 0.99
R6525:Fat2 UTSW 11 55283800 missense probably damaging 1.00
R6617:Fat2 UTSW 11 55296105 missense probably benign 0.01
R6652:Fat2 UTSW 11 55252262 missense probably benign
R6679:Fat2 UTSW 11 55309305 missense probably damaging 1.00
R6680:Fat2 UTSW 11 55310858 nonsense probably null
R6762:Fat2 UTSW 11 55253482 splice site probably null
R6810:Fat2 UTSW 11 55282241 missense possibly damaging 0.88
R6818:Fat2 UTSW 11 55309341 missense probably benign 0.31
R6919:Fat2 UTSW 11 55282771 missense possibly damaging 0.68
R6939:Fat2 UTSW 11 55252474 nonsense probably null
R6941:Fat2 UTSW 11 55262088 missense probably benign
R7023:Fat2 UTSW 11 55310502 missense probably benign 0.00
R7027:Fat2 UTSW 11 55269433 missense probably benign 0.03
R7027:Fat2 UTSW 11 55281851 nonsense probably null
R7095:Fat2 UTSW 11 55311331 missense probably damaging 1.00
R7102:Fat2 UTSW 11 55283434 missense probably damaging 1.00
R7116:Fat2 UTSW 11 55282336 missense probably damaging 1.00
R7117:Fat2 UTSW 11 55281262 missense probably damaging 1.00
R7167:Fat2 UTSW 11 55285001 missense possibly damaging 0.48
R7213:Fat2 UTSW 11 55281045 nonsense probably null
R7246:Fat2 UTSW 11 55296382 missense probably benign 0.00
R7252:Fat2 UTSW 11 55311262 missense probably damaging 0.98
R7266:Fat2 UTSW 11 55285030 missense probably damaging 0.99
R7316:Fat2 UTSW 11 55286067 missense probably damaging 1.00
R7326:Fat2 UTSW 11 55282304 missense probably damaging 0.99
R7355:Fat2 UTSW 11 55256551 missense probably benign 0.00
R7431:Fat2 UTSW 11 55309101 missense probably damaging 1.00
R7459:Fat2 UTSW 11 55303919 missense probably damaging 1.00
R7460:Fat2 UTSW 11 55278963 missense probably damaging 1.00
R7466:Fat2 UTSW 11 55310432 missense probably damaging 1.00
R7475:Fat2 UTSW 11 55303653 missense probably benign 0.31
R7678:Fat2 UTSW 11 55282330 missense probably damaging 0.99
R7689:Fat2 UTSW 11 55309840 missense probably damaging 1.00
R7704:Fat2 UTSW 11 55284347 missense probably benign 0.03
R7710:Fat2 UTSW 11 55310763 missense probably benign 0.35
R7724:Fat2 UTSW 11 55284796 missense probably damaging 1.00
R7731:Fat2 UTSW 11 55310706 missense probably damaging 1.00
R7739:Fat2 UTSW 11 55281131 nonsense probably null
R7757:Fat2 UTSW 11 55311421 missense probably benign 0.00
R7876:Fat2 UTSW 11 55311220 missense probably benign 0.01
R7883:Fat2 UTSW 11 55253364 splice site probably null
R7924:Fat2 UTSW 11 55262787 missense probably benign 0.03
R7936:Fat2 UTSW 11 55310167 missense probably benign
R7936:Fat2 UTSW 11 55311160 nonsense probably null
R7938:Fat2 UTSW 11 55273096 missense probably damaging 1.00
R7947:Fat2 UTSW 11 55287734 missense probably damaging 1.00
R8049:Fat2 UTSW 11 55312066 missense probably benign 0.13
R8094:Fat2 UTSW 11 55296139 missense probably benign 0.06
R8157:Fat2 UTSW 11 55252084 missense possibly damaging 0.90
R8170:Fat2 UTSW 11 55270455 missense probably damaging 1.00
R8172:Fat2 UTSW 11 55287812 missense probably damaging 1.00
R8182:Fat2 UTSW 11 55284397 missense possibly damaging 0.51
R8188:Fat2 UTSW 11 55273171 missense probably damaging 0.98
R8204:Fat2 UTSW 11 55284610 missense probably benign 0.02
R8211:Fat2 UTSW 11 55312209 missense possibly damaging 0.92
R8255:Fat2 UTSW 11 55270275 missense probably benign 0.19
R8263:Fat2 UTSW 11 55284136 missense probably benign
R8269:Fat2 UTSW 11 55282709 missense possibly damaging 0.48
R8443:Fat2 UTSW 11 55311709 missense probably damaging 1.00
R8465:Fat2 UTSW 11 55256704 missense possibly damaging 0.61
R8480:Fat2 UTSW 11 55282968 missense possibly damaging 0.61
R8511:Fat2 UTSW 11 55309237 missense probably damaging 0.99
R8680:Fat2 UTSW 11 55253866 missense probably benign
R8704:Fat2 UTSW 11 55281311 missense probably damaging 1.00
R8711:Fat2 UTSW 11 55268303 missense probably benign 0.22
R8724:Fat2 UTSW 11 55282960 missense probably damaging 1.00
R8788:Fat2 UTSW 11 55281103 missense possibly damaging 0.90
R8802:Fat2 UTSW 11 55282924 missense possibly damaging 0.95
R8902:Fat2 UTSW 11 55310070 missense probably damaging 1.00
R8940:Fat2 UTSW 11 55256810 missense possibly damaging 0.48
R8956:Fat2 UTSW 11 55282903 missense probably damaging 1.00
R9035:Fat2 UTSW 11 55303721 missense probably damaging 0.99
R9100:Fat2 UTSW 11 55262521 missense probably damaging 1.00
R9132:Fat2 UTSW 11 55298610 missense possibly damaging 0.88
R9173:Fat2 UTSW 11 55278937 missense probably damaging 1.00
R9241:Fat2 UTSW 11 55256740 missense probably benign 0.00
R9253:Fat2 UTSW 11 55310571 missense probably damaging 1.00
R9280:Fat2 UTSW 11 55310697 missense probably benign 0.36
R9351:Fat2 UTSW 11 55281301 missense probably damaging 1.00
R9369:Fat2 UTSW 11 55310688 missense possibly damaging 0.67
R9404:Fat2 UTSW 11 55253522 critical splice donor site probably null
R9431:Fat2 UTSW 11 55252012 missense probably damaging 1.00
R9509:Fat2 UTSW 11 55309887 missense possibly damaging 0.51
R9514:Fat2 UTSW 11 55284982 missense probably damaging 0.98
R9606:Fat2 UTSW 11 55289267 missense probably damaging 1.00
R9630:Fat2 UTSW 11 55256779 missense probably benign 0.29
X0010:Fat2 UTSW 11 55252260 missense probably benign 0.00
X0011:Fat2 UTSW 11 55310431 missense probably damaging 0.98
X0018:Fat2 UTSW 11 55296210 missense probably damaging 1.00
X0028:Fat2 UTSW 11 55309414 missense possibly damaging 0.84
X0067:Fat2 UTSW 11 55283234 missense possibly damaging 0.48
Z1176:Fat2 UTSW 11 55282795 missense probably damaging 1.00
Z1176:Fat2 UTSW 11 55284991 missense probably damaging 1.00
Z1176:Fat2 UTSW 11 55303700 missense probably damaging 1.00
Z1176:Fat2 UTSW 11 55310121 missense probably damaging 0.96
Z1177:Fat2 UTSW 11 55278966 nonsense probably null
Z1186:Fat2 UTSW 11 55308970 frame shift probably null
Z1186:Fat2 UTSW 11 55309799 missense probably benign
Z1187:Fat2 UTSW 11 55308970 frame shift probably null
Z1187:Fat2 UTSW 11 55309799 missense probably benign
Z1188:Fat2 UTSW 11 55308970 frame shift probably null
Z1188:Fat2 UTSW 11 55309799 missense probably benign
Z1189:Fat2 UTSW 11 55308970 frame shift probably null
Z1189:Fat2 UTSW 11 55309799 missense probably benign
Z1190:Fat2 UTSW 11 55308970 frame shift probably null
Z1190:Fat2 UTSW 11 55309799 missense probably benign
Z1191:Fat2 UTSW 11 55308970 frame shift probably null
Z1191:Fat2 UTSW 11 55309799 missense probably benign
Z1192:Fat2 UTSW 11 55308970 frame shift probably null
Z1192:Fat2 UTSW 11 55309799 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCTCAGAAATGGTGAGCTG -3'
(R):5'- CACCTCCCTTGGCAACTATCAG -3'

Sequencing Primer
(F):5'- CCTCAGAAATGGTGAGCTGGTATCC -3'
(R):5'- AACCATCATGCTCCTCAGTTTGAG -3'
Posted On 2022-07-18