Incidental Mutation 'R9484:Slc13a2'
ID 716467
Institutional Source Beutler Lab
Gene Symbol Slc13a2
Ensembl Gene ENSMUSG00000001095
Gene Name solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2
Synonyms sodium/dicarboxylate co-transporter, mNaDC-1, Nadc1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 78288102-78313107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78294233 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 216 (L216Q)
Ref Sequence ENSEMBL: ENSMUSP00000001122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001122]
AlphaFold Q9ES88
Predicted Effect probably damaging
Transcript: ENSMUST00000001122
AA Change: L216Q

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001122
Gene: ENSMUSG00000001095
AA Change: L216Q

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 6 560 7.1e-161 PFAM
Pfam:CitMHS 45 164 3e-15 PFAM
Pfam:CitMHS 203 499 1.5e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-coupled citrate transporter that is regulated by the chaperone activity of cyclophilin b. The encoded protein may play a role in the formation of kidney stones. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased Kreb cycle intermediates in the urine but otherwise have normal kidney function and response to ischemia-reperfusion injury and caloric restriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,250,845 (GRCm39) C151S probably damaging Het
Actr8 T C 14: 29,708,301 (GRCm39) I193T probably benign Het
Btbd2 T C 10: 80,480,103 (GRCm39) N419S probably benign Het
Cacna2d1 T A 5: 16,561,831 (GRCm39) W821R probably damaging Het
Cadps2 T C 6: 23,626,646 (GRCm39) Y214C probably benign Het
Calu T A 6: 29,366,162 (GRCm39) L180Q probably damaging Het
Corin C T 5: 72,497,280 (GRCm39) V615I probably damaging Het
Cyp8b1 A T 9: 121,744,983 (GRCm39) D116E probably benign Het
D630036H23Rik C A 12: 36,431,711 (GRCm39) A96S unknown Het
Ddx24 A T 12: 103,377,555 (GRCm39) Y717N probably damaging Het
Dmap1 G T 4: 117,533,308 (GRCm39) Q249K probably benign Het
Dnah10 T A 5: 124,900,508 (GRCm39) W3922R probably damaging Het
Dnah14 T C 1: 181,517,773 (GRCm39) F2036L probably benign Het
Dnah14 T C 1: 181,625,311 (GRCm39) I4064T probably benign Het
Dock9 A C 14: 121,818,844 (GRCm39) V1546G probably damaging Het
Eif1ad4 A T 12: 87,862,249 (GRCm39) Q37L possibly damaging Het
Eif3a A T 19: 60,755,006 (GRCm39) S1059T unknown Het
Ep300 A G 15: 81,521,026 (GRCm39) E1262G unknown Het
Evl T A 12: 108,652,716 (GRCm39) I387N probably damaging Het
Fat2 A C 11: 55,200,752 (GRCm39) V774G probably damaging Het
Fez1 T A 9: 36,755,093 (GRCm39) Y31N probably benign Het
Fkbp10 A G 11: 100,313,960 (GRCm39) I435V probably damaging Het
Flnb A G 14: 7,929,004 (GRCm38) D1911G probably benign Het
Fnbp1 T C 2: 30,973,038 (GRCm39) Y154C probably benign Het
Fndc10 T C 4: 155,779,496 (GRCm39) I180T possibly damaging Het
Frmd4a G A 2: 4,609,026 (GRCm39) V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 (GRCm39) H64R possibly damaging Het
Glis3 T C 19: 28,508,403 (GRCm39) D527G probably damaging Het
H2-Ob T A 17: 34,459,989 (GRCm39) F33L probably damaging Het
Hbb-bh1 C T 7: 103,492,239 (GRCm39) E27K probably benign Het
Ifnb1 T A 4: 88,440,915 (GRCm39) T33S probably benign Het
Igkv4-80 T A 6: 68,993,766 (GRCm39) T42S probably damaging Het
Irs2 C T 8: 11,057,334 (GRCm39) G366D probably damaging Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,068 (GRCm39) C302S unknown Het
Lgi1 A G 19: 38,294,757 (GRCm39) K510E probably benign Het
Lgi2 T A 5: 52,695,936 (GRCm39) D341V probably benign Het
Lin7c T C 2: 109,724,813 (GRCm39) I14T probably benign Het
Lrrc19 A T 4: 94,531,573 (GRCm39) M13K probably benign Het
Lrrc69 T C 4: 14,666,012 (GRCm39) I315M probably benign Het
Mtcl3 G A 10: 29,072,969 (GRCm39) D754N probably damaging Het
Myo5c A T 9: 75,204,770 (GRCm39) D1541V probably damaging Het
Mypn T G 10: 63,003,019 (GRCm39) M373L probably benign Het
Nckipsd C A 9: 108,689,837 (GRCm39) H333N probably damaging Het
Nrg2 A T 18: 36,157,401 (GRCm39) L428Q probably null Het
Or13a20 T C 7: 140,231,904 (GRCm39) L4S probably benign Het
Or2b28 C A 13: 21,531,587 (GRCm39) T163K probably damaging Het
Or5an11 T C 19: 12,245,735 (GRCm39) I47T possibly damaging Het
Otogl T A 10: 107,657,894 (GRCm39) probably null Het
Otogl C T 10: 107,737,156 (GRCm39) G86D probably damaging Het
Papln A T 12: 83,838,618 (GRCm39) Q1249L probably benign Het
Plxna2 G T 1: 194,327,202 (GRCm39) G379C probably damaging Het
Pofut2 T C 10: 77,095,260 (GRCm39) I35T probably benign Het
Pros1 A G 16: 62,744,887 (GRCm39) T501A possibly damaging Het
Rapgef1 T C 2: 29,625,821 (GRCm39) S1042P possibly damaging Het
Rps6kb1 C T 11: 86,408,443 (GRCm39) E185K probably damaging Het
Slc22a14 T C 9: 119,009,615 (GRCm39) Y160C probably damaging Het
Slc22a4 T A 11: 53,879,773 (GRCm39) I429F possibly damaging Het
Slc26a3 A G 12: 31,511,785 (GRCm39) K457E probably damaging Het
Slc47a2 T C 11: 61,227,060 (GRCm39) I169M possibly damaging Het
Slco1a1 C T 6: 141,854,672 (GRCm39) V660I probably benign Het
Smyd1 A G 6: 71,202,450 (GRCm39) Y252H probably damaging Het
Spp2 A T 1: 88,334,695 (GRCm39) probably benign Het
Stra8 T A 6: 34,911,121 (GRCm39) W250R probably damaging Het
Syne1 A C 10: 5,170,359 (GRCm39) L5183R probably damaging Het
Tdrd9 T C 12: 112,012,684 (GRCm39) S1203P probably damaging Het
Th C A 7: 142,453,620 (GRCm39) E27* probably null Het
Thada C A 17: 84,736,619 (GRCm39) L887F probably damaging Het
Timm23 T C 14: 31,902,586 (GRCm39) T186A probably benign Het
Tmem132b A T 5: 125,860,420 (GRCm39) E555V probably damaging Het
Tnik A T 3: 28,649,093 (GRCm39) Q457L unknown Het
Uba7 C A 9: 107,861,037 (GRCm39) H942Q probably benign Het
Upf2 T C 2: 5,966,078 (GRCm39) S233P unknown Het
Urm1 T A 2: 29,732,760 (GRCm39) N72K probably damaging Het
Usp10 T C 8: 120,675,504 (GRCm39) S508P possibly damaging Het
Usp37 G A 1: 74,499,081 (GRCm39) P632S probably damaging Het
Wdr77 T A 3: 105,872,404 (GRCm39) N209K probably benign Het
Zbtb24 C T 10: 41,327,429 (GRCm39) T105M probably benign Het
Zfp341 T A 2: 154,485,763 (GRCm39) I671N probably damaging Het
Zfp414 A G 17: 33,848,984 (GRCm39) T73A probably benign Het
Zfp574 A T 7: 24,781,404 (GRCm39) I809F possibly damaging Het
Zfp62 T C 11: 49,108,108 (GRCm39) I733T probably damaging Het
Zfp719 A G 7: 43,239,581 (GRCm39) I390V possibly damaging Het
Other mutations in Slc13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Slc13a2 APN 11 78,291,374 (GRCm39) missense probably damaging 1.00
IGL01604:Slc13a2 APN 11 78,294,221 (GRCm39) missense possibly damaging 0.82
IGL01679:Slc13a2 APN 11 78,295,537 (GRCm39) missense probably damaging 1.00
IGL03100:Slc13a2 APN 11 78,295,299 (GRCm39) missense probably damaging 1.00
IGL03380:Slc13a2 APN 11 78,289,908 (GRCm39) missense probably benign 0.03
deliberate UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
Familiaris UTSW 11 78,295,621 (GRCm39) missense probably damaging 1.00
intentional UTSW 11 78,295,534 (GRCm39) missense probably damaging 1.00
R0085:Slc13a2 UTSW 11 78,297,694 (GRCm39) missense probably damaging 0.96
R0324:Slc13a2 UTSW 11 78,295,350 (GRCm39) missense probably damaging 1.00
R0368:Slc13a2 UTSW 11 78,295,626 (GRCm39) nonsense probably null
R0440:Slc13a2 UTSW 11 78,294,001 (GRCm39) missense probably benign 0.05
R0539:Slc13a2 UTSW 11 78,289,964 (GRCm39) missense probably damaging 1.00
R1519:Slc13a2 UTSW 11 78,288,572 (GRCm39) missense possibly damaging 0.59
R1550:Slc13a2 UTSW 11 78,293,990 (GRCm39) missense probably damaging 1.00
R1909:Slc13a2 UTSW 11 78,290,968 (GRCm39) missense possibly damaging 0.90
R2166:Slc13a2 UTSW 11 78,293,901 (GRCm39) missense probably benign 0.16
R2994:Slc13a2 UTSW 11 78,295,563 (GRCm39) missense probably damaging 1.00
R2998:Slc13a2 UTSW 11 78,295,611 (GRCm39) missense probably damaging 0.99
R3418:Slc13a2 UTSW 11 78,291,666 (GRCm39) missense probably benign 0.05
R3932:Slc13a2 UTSW 11 78,289,226 (GRCm39) missense probably damaging 1.00
R4233:Slc13a2 UTSW 11 78,294,361 (GRCm39) intron probably benign
R4462:Slc13a2 UTSW 11 78,295,213 (GRCm39) missense probably benign 0.44
R5014:Slc13a2 UTSW 11 78,290,987 (GRCm39) missense possibly damaging 0.73
R5170:Slc13a2 UTSW 11 78,291,634 (GRCm39) missense probably damaging 1.00
R5484:Slc13a2 UTSW 11 78,295,648 (GRCm39) splice site probably benign
R5809:Slc13a2 UTSW 11 78,288,647 (GRCm39) missense probably damaging 1.00
R5973:Slc13a2 UTSW 11 78,291,358 (GRCm39) missense probably damaging 0.99
R6243:Slc13a2 UTSW 11 78,295,534 (GRCm39) missense probably damaging 1.00
R6263:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6275:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6276:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6279:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6280:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6300:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6305:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6314:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6673:Slc13a2 UTSW 11 78,288,657 (GRCm39) missense probably benign 0.12
R7138:Slc13a2 UTSW 11 78,289,950 (GRCm39) missense possibly damaging 0.76
R7382:Slc13a2 UTSW 11 78,295,621 (GRCm39) missense probably damaging 1.00
R7657:Slc13a2 UTSW 11 78,289,223 (GRCm39) missense probably damaging 0.99
R7791:Slc13a2 UTSW 11 78,312,890 (GRCm39) critical splice donor site probably null
R8027:Slc13a2 UTSW 11 78,295,582 (GRCm39) missense probably benign 0.00
R9091:Slc13a2 UTSW 11 78,295,258 (GRCm39) missense probably damaging 1.00
R9270:Slc13a2 UTSW 11 78,295,258 (GRCm39) missense probably damaging 1.00
R9501:Slc13a2 UTSW 11 78,291,633 (GRCm39) missense probably damaging 1.00
R9783:Slc13a2 UTSW 11 78,294,177 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTAAAACTGCCTGGTCC -3'
(R):5'- AGAACGTGTCTGAGAAGCCC -3'

Sequencing Primer
(F):5'- GGTCCCATTTGTCACTCAGTGAG -3'
(R):5'- TGTCTGAGAAGCCCACAGC -3'
Posted On 2022-07-18