Incidental Mutation 'R9484:Tdrd9'
ID 716476
Institutional Source Beutler Lab
Gene Symbol Tdrd9
Ensembl Gene ENSMUSG00000054003
Gene Name tudor domain containing 9
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock # R9484 (G1)
Quality Score 197.009
Status Not validated
Chromosome 12
Chromosomal Location 111971559-112068854 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112046250 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1203 (S1203P)
Ref Sequence ENSEMBL: ENSMUSP00000078022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009]
AlphaFold Q14BI7
Predicted Effect probably damaging
Transcript: ENSMUST00000079009
AA Change: S1203P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003
AA Change: S1203P

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191808
Predicted Effect probably benign
Transcript: ENSMUST00000192125
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,112,786 C151S probably damaging Het
Actr8 T C 14: 29,986,344 I193T probably benign Het
Btbd2 T C 10: 80,644,269 N419S probably benign Het
Cacna2d1 T A 5: 16,356,833 W821R probably damaging Het
Cadps2 T C 6: 23,626,647 Y214C probably benign Het
Calu T A 6: 29,366,163 L180Q probably damaging Het
Corin C T 5: 72,339,937 V615I probably damaging Het
Cyp8b1 A T 9: 121,915,917 D116E probably benign Het
D630036H23Rik C A 12: 36,381,712 A96S unknown Het
Ddx24 A T 12: 103,411,296 Y717N probably damaging Het
Dmap1 G T 4: 117,676,111 Q249K probably benign Het
Dnah10 T A 5: 124,823,444 W3922R probably damaging Het
Dnah14 T C 1: 181,690,208 F2036L probably benign Het
Dnah14 T C 1: 181,797,746 I4064T probably benign Het
Dock9 A C 14: 121,581,432 V1546G probably damaging Het
Eif3a A T 19: 60,766,568 S1059T unknown Het
Ep300 A G 15: 81,636,825 E1262G unknown Het
Evl T A 12: 108,686,457 I387N probably damaging Het
Fat2 A C 11: 55,309,926 V774G probably damaging Het
Fez1 T A 9: 36,843,797 Y31N probably benign Het
Fkbp10 A G 11: 100,423,134 I435V probably damaging Het
Flnb A G 14: 7,929,004 D1911G probably benign Het
Fnbp1 T C 2: 31,083,026 Y154C probably benign Het
Fndc10 T C 4: 155,695,039 I180T possibly damaging Het
Frmd4a G A 2: 4,604,215 V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 H64R possibly damaging Het
Glis3 T C 19: 28,531,003 D527G probably damaging Het
Gm2022 A T 12: 87,895,479 Q37L possibly damaging Het
H2-Ob T A 17: 34,241,015 F33L probably damaging Het
Hbb-bh1 C T 7: 103,843,032 E27K probably benign Het
Ifnb1 T A 4: 88,522,678 T33S probably benign Het
Igkv4-80 T A 6: 69,016,782 T42S probably damaging Het
Irs2 C T 8: 11,007,334 G366D probably damaging Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Krtap5-3 T A 7: 142,202,331 C302S unknown Het
Lgi1 A G 19: 38,306,309 K510E probably benign Het
Lgi2 T A 5: 52,538,594 D341V probably benign Het
Lin7c T C 2: 109,894,468 I14T probably benign Het
Lrrc19 A T 4: 94,643,336 M13K probably benign Het
Lrrc69 T C 4: 14,666,012 I315M probably benign Het
Myo5c A T 9: 75,297,488 D1541V probably damaging Het
Mypn T G 10: 63,167,240 M373L probably benign Het
Nckipsd C A 9: 108,812,638 H333N probably damaging Het
Nrg2 A T 18: 36,024,348 L428Q probably null Het
Olfr1367 C A 13: 21,347,417 T163K probably damaging Het
Olfr235 T C 19: 12,268,371 I47T possibly damaging Het
Olfr53 T C 7: 140,651,991 L4S probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otogl C T 10: 107,901,295 G86D probably damaging Het
Papln A T 12: 83,791,844 Q1249L probably benign Het
Plxna2 G T 1: 194,644,894 G379C probably damaging Het
Pofut2 T C 10: 77,259,426 I35T probably benign Het
Pros1 A G 16: 62,924,524 T501A possibly damaging Het
Rapgef1 T C 2: 29,735,809 S1042P possibly damaging Het
Rps6kb1 C T 11: 86,517,617 E185K probably damaging Het
Slc13a2 A T 11: 78,403,407 L216Q probably damaging Het
Slc22a14 T C 9: 119,180,549 Y160C probably damaging Het
Slc22a4 T A 11: 53,988,947 I429F possibly damaging Het
Slc26a3 A G 12: 31,461,786 K457E probably damaging Het
Slc47a2 T C 11: 61,336,234 I169M possibly damaging Het
Slco1a1 C T 6: 141,908,946 V660I probably benign Het
Smyd1 A G 6: 71,225,466 Y252H probably damaging Het
Soga3 G A 10: 29,196,973 D754N probably damaging Het
Spp2 A T 1: 88,406,973 probably benign Het
Stra8 T A 6: 34,934,186 W250R probably damaging Het
Syne1 A C 10: 5,220,359 L5183R probably damaging Het
Th C A 7: 142,899,883 E27* probably null Het
Thada C A 17: 84,429,191 L887F probably damaging Het
Timm23 T C 14: 32,180,629 T186A probably benign Het
Tmem132b A T 5: 125,783,356 E555V probably damaging Het
Tnik A T 3: 28,594,944 Q457L unknown Het
Uba7 C A 9: 107,983,838 H942Q probably benign Het
Upf2 T C 2: 5,961,267 S233P unknown Het
Urm1 T A 2: 29,842,748 N72K probably damaging Het
Usp10 T C 8: 119,948,765 S508P possibly damaging Het
Usp37 G A 1: 74,459,922 P632S probably damaging Het
Wdr77 T A 3: 105,965,088 N209K probably benign Het
Zbtb24 C T 10: 41,451,433 T105M probably benign Het
Zfp341 T A 2: 154,643,843 I671N probably damaging Het
Zfp414 A G 17: 33,630,010 T73A probably benign Het
Zfp574 A T 7: 25,081,979 I809F possibly damaging Het
Zfp62 T C 11: 49,217,281 I733T probably damaging Het
Zfp719 A G 7: 43,590,157 I390V possibly damaging Het
Other mutations in Tdrd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01373:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01542:Tdrd9 APN 12 112046989 missense possibly damaging 0.94
IGL02967:Tdrd9 APN 12 111992488 missense possibly damaging 0.50
IGL03063:Tdrd9 APN 12 112044299 missense probably benign 0.00
IGL03107:Tdrd9 APN 12 112042840 missense probably damaging 0.98
R0433:Tdrd9 UTSW 12 112025581 nonsense probably null
R0453:Tdrd9 UTSW 12 112068239 missense probably benign
R0655:Tdrd9 UTSW 12 112040465 missense probably damaging 1.00
R0666:Tdrd9 UTSW 12 112007580 intron probably benign
R1073:Tdrd9 UTSW 12 112023259 missense probably damaging 1.00
R1280:Tdrd9 UTSW 12 112039408 missense probably damaging 1.00
R1386:Tdrd9 UTSW 12 112044804 missense probably benign 0.21
R1521:Tdrd9 UTSW 12 112036410 missense probably damaging 1.00
R1601:Tdrd9 UTSW 12 112023253 nonsense probably null
R1651:Tdrd9 UTSW 12 112024706 missense probably damaging 0.97
R1715:Tdrd9 UTSW 12 112036439 missense possibly damaging 0.62
R1854:Tdrd9 UTSW 12 112044812 missense probably damaging 1.00
R1905:Tdrd9 UTSW 12 112063627 splice site probably benign
R2386:Tdrd9 UTSW 12 112015900 missense probably damaging 1.00
R2863:Tdrd9 UTSW 12 112031261 missense probably benign
R2915:Tdrd9 UTSW 12 112040461 missense probably damaging 1.00
R2958:Tdrd9 UTSW 12 112041672 missense probably damaging 0.97
R4033:Tdrd9 UTSW 12 111992539 missense possibly damaging 0.58
R4087:Tdrd9 UTSW 12 112013486 nonsense probably null
R4237:Tdrd9 UTSW 12 112067625 nonsense probably null
R4482:Tdrd9 UTSW 12 112014501 critical splice donor site probably null
R4501:Tdrd9 UTSW 12 112042809 missense probably benign 0.00
R4502:Tdrd9 UTSW 12 111993825 missense probably damaging 1.00
R4715:Tdrd9 UTSW 12 112041689 missense probably benign 0.00
R4803:Tdrd9 UTSW 12 111996835 nonsense probably null
R5218:Tdrd9 UTSW 12 112063475 intron probably benign
R5275:Tdrd9 UTSW 12 112051912 nonsense probably null
R5295:Tdrd9 UTSW 12 112051912 nonsense probably null
R5301:Tdrd9 UTSW 12 112036529 critical splice donor site probably null
R5339:Tdrd9 UTSW 12 112027122 missense probably damaging 1.00
R5500:Tdrd9 UTSW 12 112023268 missense probably benign 0.02
R5573:Tdrd9 UTSW 12 111997902 splice site probably null
R5590:Tdrd9 UTSW 12 112051980 missense probably benign 0.01
R5891:Tdrd9 UTSW 12 112042719 missense probably damaging 1.00
R6056:Tdrd9 UTSW 12 111985041 missense probably damaging 1.00
R6057:Tdrd9 UTSW 12 112013286 missense possibly damaging 0.85
R6125:Tdrd9 UTSW 12 112068198 missense possibly damaging 0.89
R6254:Tdrd9 UTSW 12 112025900 splice site probably null
R6335:Tdrd9 UTSW 12 112041752 critical splice donor site probably null
R6345:Tdrd9 UTSW 12 112034608 missense probably damaging 0.99
R6792:Tdrd9 UTSW 12 112027113 missense probably benign 0.01
R6956:Tdrd9 UTSW 12 112036354 splice site probably benign
R6987:Tdrd9 UTSW 12 112025593 missense possibly damaging 0.82
R7090:Tdrd9 UTSW 12 111992470 missense probably benign
R7158:Tdrd9 UTSW 12 112036366 missense probably benign 0.08
R7220:Tdrd9 UTSW 12 112014454 missense probably damaging 1.00
R7478:Tdrd9 UTSW 12 111985042 missense probably damaging 1.00
R7489:Tdrd9 UTSW 12 112067637 missense probably benign 0.00
R7751:Tdrd9 UTSW 12 111992548 missense probably benign 0.09
R7809:Tdrd9 UTSW 12 112032721 missense probably damaging 0.99
R7844:Tdrd9 UTSW 12 111997952 missense possibly damaging 0.63
R7854:Tdrd9 UTSW 12 112046961 missense probably benign 0.00
R7903:Tdrd9 UTSW 12 112051976 missense possibly damaging 0.95
R7938:Tdrd9 UTSW 12 112031215 missense possibly damaging 0.86
R8018:Tdrd9 UTSW 12 112032746 missense probably benign 0.12
R8018:Tdrd9 UTSW 12 112044388 missense probably damaging 0.99
R8090:Tdrd9 UTSW 12 112015935 missense probably damaging 1.00
R8157:Tdrd9 UTSW 12 111985066 missense probably benign 0.44
R8198:Tdrd9 UTSW 12 112040429 missense probably damaging 1.00
R8203:Tdrd9 UTSW 12 112025630 missense probably damaging 1.00
R8512:Tdrd9 UTSW 12 112046193 missense probably benign
R8721:Tdrd9 UTSW 12 112036455 missense probably damaging 1.00
R8889:Tdrd9 UTSW 12 112013284 missense probably benign 0.07
R8892:Tdrd9 UTSW 12 112013284 missense probably benign 0.07
R9276:Tdrd9 UTSW 12 112014501 critical splice donor site probably null
R9459:Tdrd9 UTSW 12 112025573 missense probably damaging 1.00
R9657:Tdrd9 UTSW 12 112036390 missense possibly damaging 0.50
R9745:Tdrd9 UTSW 12 112042696 missense probably damaging 0.99
X0018:Tdrd9 UTSW 12 112039329 missense probably benign 0.24
Z1177:Tdrd9 UTSW 12 111971654 missense probably benign 0.08
Z1177:Tdrd9 UTSW 12 111993891 missense probably damaging 0.96
Z1177:Tdrd9 UTSW 12 112015921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTCTGAGGTTCACTCTGG -3'
(R):5'- GCACTCAGAAAAGAGCTTAACG -3'

Sequencing Primer
(F):5'- TCACTCTGGGCTGGCATG -3'
(R):5'- ACAGGACCCAGGTTCATTTCTCAG -3'
Posted On 2022-07-18