Incidental Mutation 'R9484:Flnb'
ID 716478
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9484 (G1)
Quality Score 198.009
Status Not validated
Chromosome 14
Chromosomal Location 7817957-7951588 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7929004 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1911 (D1911G)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably benign
Transcript: ENSMUST00000052678
AA Change: D1911G

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: D1911G

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,112,786 C151S probably damaging Het
Actr8 T C 14: 29,986,344 I193T probably benign Het
Btbd2 T C 10: 80,644,269 N419S probably benign Het
Cacna2d1 T A 5: 16,356,833 W821R probably damaging Het
Cadps2 T C 6: 23,626,647 Y214C probably benign Het
Calu T A 6: 29,366,163 L180Q probably damaging Het
Corin C T 5: 72,339,937 V615I probably damaging Het
Cyp8b1 A T 9: 121,915,917 D116E probably benign Het
D630036H23Rik C A 12: 36,381,712 A96S unknown Het
Ddx24 A T 12: 103,411,296 Y717N probably damaging Het
Dmap1 G T 4: 117,676,111 Q249K probably benign Het
Dnah10 T A 5: 124,823,444 W3922R probably damaging Het
Dnah14 T C 1: 181,690,208 F2036L probably benign Het
Dnah14 T C 1: 181,797,746 I4064T probably benign Het
Dock9 A C 14: 121,581,432 V1546G probably damaging Het
Eif3a A T 19: 60,766,568 S1059T unknown Het
Ep300 A G 15: 81,636,825 E1262G unknown Het
Evl T A 12: 108,686,457 I387N probably damaging Het
Fat2 A C 11: 55,309,926 V774G probably damaging Het
Fez1 T A 9: 36,843,797 Y31N probably benign Het
Fkbp10 A G 11: 100,423,134 I435V probably damaging Het
Fnbp1 T C 2: 31,083,026 Y154C probably benign Het
Fndc10 T C 4: 155,695,039 I180T possibly damaging Het
Frmd4a G A 2: 4,604,215 V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 H64R possibly damaging Het
Glis3 T C 19: 28,531,003 D527G probably damaging Het
Gm2022 A T 12: 87,895,479 Q37L possibly damaging Het
H2-Ob T A 17: 34,241,015 F33L probably damaging Het
Hbb-bh1 C T 7: 103,843,032 E27K probably benign Het
Ifnb1 T A 4: 88,522,678 T33S probably benign Het
Igkv4-80 T A 6: 69,016,782 T42S probably damaging Het
Irs2 C T 8: 11,007,334 G366D probably damaging Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Krtap5-3 T A 7: 142,202,331 C302S unknown Het
Lgi1 A G 19: 38,306,309 K510E probably benign Het
Lgi2 T A 5: 52,538,594 D341V probably benign Het
Lin7c T C 2: 109,894,468 I14T probably benign Het
Lrrc19 A T 4: 94,643,336 M13K probably benign Het
Lrrc69 T C 4: 14,666,012 I315M probably benign Het
Myo5c A T 9: 75,297,488 D1541V probably damaging Het
Mypn T G 10: 63,167,240 M373L probably benign Het
Nckipsd C A 9: 108,812,638 H333N probably damaging Het
Nrg2 A T 18: 36,024,348 L428Q probably null Het
Olfr1367 C A 13: 21,347,417 T163K probably damaging Het
Olfr235 T C 19: 12,268,371 I47T possibly damaging Het
Olfr53 T C 7: 140,651,991 L4S probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otogl C T 10: 107,901,295 G86D probably damaging Het
Papln A T 12: 83,791,844 Q1249L probably benign Het
Plxna2 G T 1: 194,644,894 G379C probably damaging Het
Pofut2 T C 10: 77,259,426 I35T probably benign Het
Pros1 A G 16: 62,924,524 T501A possibly damaging Het
Rapgef1 T C 2: 29,735,809 S1042P possibly damaging Het
Rps6kb1 C T 11: 86,517,617 E185K probably damaging Het
Slc13a2 A T 11: 78,403,407 L216Q probably damaging Het
Slc22a14 T C 9: 119,180,549 Y160C probably damaging Het
Slc22a4 T A 11: 53,988,947 I429F possibly damaging Het
Slc26a3 A G 12: 31,461,786 K457E probably damaging Het
Slc47a2 T C 11: 61,336,234 I169M possibly damaging Het
Slco1a1 C T 6: 141,908,946 V660I probably benign Het
Smyd1 A G 6: 71,225,466 Y252H probably damaging Het
Soga3 G A 10: 29,196,973 D754N probably damaging Het
Spp2 A T 1: 88,406,973 probably benign Het
Stra8 T A 6: 34,934,186 W250R probably damaging Het
Syne1 A C 10: 5,220,359 L5183R probably damaging Het
Tdrd9 T C 12: 112,046,250 S1203P probably damaging Het
Th C A 7: 142,899,883 E27* probably null Het
Thada C A 17: 84,429,191 L887F probably damaging Het
Timm23 T C 14: 32,180,629 T186A probably benign Het
Tmem132b A T 5: 125,783,356 E555V probably damaging Het
Tnik A T 3: 28,594,944 Q457L unknown Het
Uba7 C A 9: 107,983,838 H942Q probably benign Het
Upf2 T C 2: 5,961,267 S233P unknown Het
Urm1 T A 2: 29,842,748 N72K probably damaging Het
Usp10 T C 8: 119,948,765 S508P possibly damaging Het
Usp37 G A 1: 74,459,922 P632S probably damaging Het
Wdr77 T A 3: 105,965,088 N209K probably benign Het
Zbtb24 C T 10: 41,451,433 T105M probably benign Het
Zfp341 T A 2: 154,643,843 I671N probably damaging Het
Zfp414 A G 17: 33,630,010 T73A probably benign Het
Zfp574 A T 7: 25,081,979 I809F possibly damaging Het
Zfp62 T C 11: 49,217,281 I733T probably damaging Het
Zfp719 A G 7: 43,590,157 I390V possibly damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
R8976:Flnb UTSW 14 7901882 critical splice acceptor site probably null
R9055:Flnb UTSW 14 7908553 missense probably benign 0.00
R9148:Flnb UTSW 14 7817996 start gained probably benign
R9179:Flnb UTSW 14 7887541 nonsense probably null
R9180:Flnb UTSW 14 7818219 missense probably damaging 1.00
R9189:Flnb UTSW 14 7892976 missense possibly damaging 0.90
R9286:Flnb UTSW 14 7873414 missense probably damaging 0.98
R9288:Flnb UTSW 14 7904498 missense probably benign 0.43
R9354:Flnb UTSW 14 7818411 missense probably benign 0.13
R9505:Flnb UTSW 14 7904665 missense probably benign
R9525:Flnb UTSW 14 7905481 missense probably damaging 1.00
R9621:Flnb UTSW 14 7926421 missense probably damaging 0.99
R9630:Flnb UTSW 14 7926438 nonsense probably null
R9739:Flnb UTSW 14 7935954 nonsense probably null
R9760:Flnb UTSW 14 7929846 missense probably damaging 0.98
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GTCATAACCACCCATTGTCCTG -3'
(R):5'- TCACCCACTTCCTAAGGAGTC -3'

Sequencing Primer
(F):5'- GCCGTGGTCATTATATACTCATTG -3'
(R):5'- CACTTCCTAAGGAGTCTCTGC -3'
Posted On 2022-07-18