Incidental Mutation 'R9484:Actr8'
ID 716479
Institutional Source Beutler Lab
Gene Symbol Actr8
Ensembl Gene ENSMUSG00000015971
Gene Name ARP8 actin-related protein 8
Synonyms 5730542K05Rik, ARP8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 29978337-30006354 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29986344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 193 (I193T)
Ref Sequence ENSEMBL: ENSMUSP00000016115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016115] [ENSMUST00000224797] [ENSMUST00000225811]
AlphaFold Q8R2S9
Predicted Effect probably benign
Transcript: ENSMUST00000016115
AA Change: I193T

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000016115
Gene: ENSMUSG00000015971
AA Change: I193T

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
ACTIN 46 621 3.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224797
AA Change: I193T

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000225811
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,112,786 C151S probably damaging Het
Btbd2 T C 10: 80,644,269 N419S probably benign Het
Cacna2d1 T A 5: 16,356,833 W821R probably damaging Het
Cadps2 T C 6: 23,626,647 Y214C probably benign Het
Calu T A 6: 29,366,163 L180Q probably damaging Het
Corin C T 5: 72,339,937 V615I probably damaging Het
Cyp8b1 A T 9: 121,915,917 D116E probably benign Het
D630036H23Rik C A 12: 36,381,712 A96S unknown Het
Ddx24 A T 12: 103,411,296 Y717N probably damaging Het
Dmap1 G T 4: 117,676,111 Q249K probably benign Het
Dnah10 T A 5: 124,823,444 W3922R probably damaging Het
Dnah14 T C 1: 181,690,208 F2036L probably benign Het
Dnah14 T C 1: 181,797,746 I4064T probably benign Het
Dock9 A C 14: 121,581,432 V1546G probably damaging Het
Eif3a A T 19: 60,766,568 S1059T unknown Het
Ep300 A G 15: 81,636,825 E1262G unknown Het
Evl T A 12: 108,686,457 I387N probably damaging Het
Fat2 A C 11: 55,309,926 V774G probably damaging Het
Fez1 T A 9: 36,843,797 Y31N probably benign Het
Fkbp10 A G 11: 100,423,134 I435V probably damaging Het
Flnb A G 14: 7,929,004 D1911G probably benign Het
Fnbp1 T C 2: 31,083,026 Y154C probably benign Het
Fndc10 T C 4: 155,695,039 I180T possibly damaging Het
Frmd4a G A 2: 4,604,215 V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 H64R possibly damaging Het
Glis3 T C 19: 28,531,003 D527G probably damaging Het
Gm2022 A T 12: 87,895,479 Q37L possibly damaging Het
H2-Ob T A 17: 34,241,015 F33L probably damaging Het
Hbb-bh1 C T 7: 103,843,032 E27K probably benign Het
Ifnb1 T A 4: 88,522,678 T33S probably benign Het
Igkv4-80 T A 6: 69,016,782 T42S probably damaging Het
Irs2 C T 8: 11,007,334 G366D probably damaging Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Krtap5-3 T A 7: 142,202,331 C302S unknown Het
Lgi1 A G 19: 38,306,309 K510E probably benign Het
Lgi2 T A 5: 52,538,594 D341V probably benign Het
Lin7c T C 2: 109,894,468 I14T probably benign Het
Lrrc19 A T 4: 94,643,336 M13K probably benign Het
Lrrc69 T C 4: 14,666,012 I315M probably benign Het
Myo5c A T 9: 75,297,488 D1541V probably damaging Het
Mypn T G 10: 63,167,240 M373L probably benign Het
Nckipsd C A 9: 108,812,638 H333N probably damaging Het
Nrg2 A T 18: 36,024,348 L428Q probably null Het
Olfr1367 C A 13: 21,347,417 T163K probably damaging Het
Olfr235 T C 19: 12,268,371 I47T possibly damaging Het
Olfr53 T C 7: 140,651,991 L4S probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otogl C T 10: 107,901,295 G86D probably damaging Het
Papln A T 12: 83,791,844 Q1249L probably benign Het
Plxna2 G T 1: 194,644,894 G379C probably damaging Het
Pofut2 T C 10: 77,259,426 I35T probably benign Het
Pros1 A G 16: 62,924,524 T501A possibly damaging Het
Rapgef1 T C 2: 29,735,809 S1042P possibly damaging Het
Rps6kb1 C T 11: 86,517,617 E185K probably damaging Het
Slc13a2 A T 11: 78,403,407 L216Q probably damaging Het
Slc22a14 T C 9: 119,180,549 Y160C probably damaging Het
Slc22a4 T A 11: 53,988,947 I429F possibly damaging Het
Slc26a3 A G 12: 31,461,786 K457E probably damaging Het
Slc47a2 T C 11: 61,336,234 I169M possibly damaging Het
Slco1a1 C T 6: 141,908,946 V660I probably benign Het
Smyd1 A G 6: 71,225,466 Y252H probably damaging Het
Soga3 G A 10: 29,196,973 D754N probably damaging Het
Spp2 A T 1: 88,406,973 probably benign Het
Stra8 T A 6: 34,934,186 W250R probably damaging Het
Syne1 A C 10: 5,220,359 L5183R probably damaging Het
Tdrd9 T C 12: 112,046,250 S1203P probably damaging Het
Th C A 7: 142,899,883 E27* probably null Het
Thada C A 17: 84,429,191 L887F probably damaging Het
Timm23 T C 14: 32,180,629 T186A probably benign Het
Tmem132b A T 5: 125,783,356 E555V probably damaging Het
Tnik A T 3: 28,594,944 Q457L unknown Het
Uba7 C A 9: 107,983,838 H942Q probably benign Het
Upf2 T C 2: 5,961,267 S233P unknown Het
Urm1 T A 2: 29,842,748 N72K probably damaging Het
Usp10 T C 8: 119,948,765 S508P possibly damaging Het
Usp37 G A 1: 74,459,922 P632S probably damaging Het
Wdr77 T A 3: 105,965,088 N209K probably benign Het
Zbtb24 C T 10: 41,451,433 T105M probably benign Het
Zfp341 T A 2: 154,643,843 I671N probably damaging Het
Zfp414 A G 17: 33,630,010 T73A probably benign Het
Zfp574 A T 7: 25,081,979 I809F possibly damaging Het
Zfp62 T C 11: 49,217,281 I733T probably damaging Het
Zfp719 A G 7: 43,590,157 I390V possibly damaging Het
Other mutations in Actr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Actr8 APN 14 29988335 missense probably damaging 1.00
IGL01449:Actr8 APN 14 29990970 critical splice donor site probably null
IGL01577:Actr8 APN 14 29987275 missense probably benign
IGL02118:Actr8 APN 14 29982771 critical splice donor site probably null
IGL02647:Actr8 APN 14 29990890 missense probably damaging 1.00
IGL02659:Actr8 APN 14 29986341 missense probably damaging 1.00
IGL02696:Actr8 APN 14 29982671 missense probably benign 0.33
IGL03015:Actr8 APN 14 29986316 missense possibly damaging 0.81
IGL03335:Actr8 APN 14 29978557 missense probably benign
R0512:Actr8 UTSW 14 29978556 missense probably benign 0.00
R0735:Actr8 UTSW 14 29989712 missense probably benign 0.02
R0926:Actr8 UTSW 14 29987224 missense probably benign 0.02
R1443:Actr8 UTSW 14 29984099 missense possibly damaging 0.73
R1470:Actr8 UTSW 14 29986969 missense possibly damaging 0.90
R1470:Actr8 UTSW 14 29986969 missense possibly damaging 0.90
R1616:Actr8 UTSW 14 29982644 missense possibly damaging 0.53
R2097:Actr8 UTSW 14 29987228 missense probably damaging 0.98
R2240:Actr8 UTSW 14 29989757 missense possibly damaging 0.94
R2570:Actr8 UTSW 14 29987282 missense probably damaging 1.00
R5122:Actr8 UTSW 14 29982715 missense possibly damaging 0.95
R5439:Actr8 UTSW 14 29986995 missense probably damaging 1.00
R5697:Actr8 UTSW 14 29991673 missense possibly damaging 0.73
R5727:Actr8 UTSW 14 29990881 missense probably benign 0.01
R5860:Actr8 UTSW 14 29986285 nonsense probably null
R5988:Actr8 UTSW 14 29993073 missense possibly damaging 0.71
R6006:Actr8 UTSW 14 29984142 critical splice donor site probably null
R6009:Actr8 UTSW 14 29978497 unclassified probably benign
R6155:Actr8 UTSW 14 29978589 critical splice donor site probably null
R6190:Actr8 UTSW 14 29991717 nonsense probably null
R6329:Actr8 UTSW 14 29993084 nonsense probably null
R6483:Actr8 UTSW 14 29978581 missense possibly damaging 0.53
R6517:Actr8 UTSW 14 29982716 nonsense probably null
R6562:Actr8 UTSW 14 29986454 splice site probably null
R7484:Actr8 UTSW 14 29992968 missense probably damaging 1.00
R8190:Actr8 UTSW 14 29984073 missense possibly damaging 0.66
R8236:Actr8 UTSW 14 29982628 missense probably damaging 1.00
R8516:Actr8 UTSW 14 29990899 missense probably benign 0.17
Z1177:Actr8 UTSW 14 29986401 missense probably damaging 1.00
Z1177:Actr8 UTSW 14 29987242 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTCTGAATTGTTGGCTGC -3'
(R):5'- TGTTTTCAAGTGTTTCCAGGACAC -3'

Sequencing Primer
(F):5'- GCTTCATGCTCAGAATCTAGAGCAG -3'
(R):5'- TCCAGGACACTATACTACATATACAC -3'
Posted On 2022-07-18