Mutagenetix > Incidental Mutation

Incidental Mutation 'R9484:Nrg2'

716487

Institutional Source

Beutler Lab

Gene Symbol

Nrg2

Ensembl Gene

ENSMUSG00000060275

Gene Name

neuregulin 2

Synonyms

NTAK, Don1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R9484 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36017707-36197380 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36024348 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 428 (L428Q)

Ref Sequence

ENSEMBL: ENSMUSP00000111378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115713]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000111377
Gene: ENSMUSG00000060275
AA Change: L242Q

Domain	Start	End	E-Value	Type
low complexity region	19	66	N/A	INTRINSIC
low complexity region	69	111	N/A	INTRINSIC
IGc2	259	329	3.85e-14	SMART
EGF	355	393	1.66e-2	SMART
Pfam:Neuregulin	403	834	1.7e-79	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115713
AA Change: L428Q

SMART Domains

Protein: ENSMUSP00000111378
Gene: ENSMUSG00000060275
AA Change: L428Q

Domain	Start	End	E-Value	Type
low complexity region	19	66	N/A	INTRINSIC
low complexity region	69	111	N/A	INTRINSIC
IGc2	259	329	3.85e-14	SMART
EGF	355	393	3.76e-1	SMART
Pfam:Neuregulin	409	844	4.4e-170	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.2%
20x: 97.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel member of the neuregulin family of growth and differentiation factors. Through interaction with the ERBB family of receptors, this protein induces the growth and differentiation of epithelial, neuronal, glial, and other types of cells. The gene consists of 12 exons and the genomic structure is similar to that of neuregulin 1, another member of the neuregulin family of ligands. The products of these genes mediate distinct biological processes by acting at different sites in tissues and eliciting different biological responses in cells. This gene is located close to the region for demyelinating Charcot-Marie-Tooth disease locus, but is not responsible for this disease. Alternative transcript variants encoding distinct isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: About one third of mice homozygous for a knock-out allele die prior to weaning in the absence of cardiac defects or other morphological abnormalities. Homozygotes display an early but transient postnatal growth deficit and reduced reproductive capacity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acads	A	T	5: 115,112,786	C151S	probably damaging	Het
Actr8	T	C	14: 29,986,344	I193T	probably benign	Het
Btbd2	T	C	10: 80,644,269	N419S	probably benign	Het
Cacna2d1	T	A	5: 16,356,833	W821R	probably damaging	Het
Cadps2	T	C	6: 23,626,647	Y214C	probably benign	Het
Calu	T	A	6: 29,366,163	L180Q	probably damaging	Het
Corin	C	T	5: 72,339,937	V615I	probably damaging	Het
Cyp8b1	A	T	9: 121,915,917	D116E	probably benign	Het
D630036H23Rik	C	A	12: 36,381,712	A96S	unknown	Het
Ddx24	A	T	12: 103,411,296	Y717N	probably damaging	Het
Dmap1	G	T	4: 117,676,111	Q249K	probably benign	Het
Dnah10	T	A	5: 124,823,444	W3922R	probably damaging	Het
Dnah14	T	C	1: 181,690,208	F2036L	probably benign	Het
Dnah14	T	C	1: 181,797,746	I4064T	probably benign	Het
Dock9	A	C	14: 121,581,432	V1546G	probably damaging	Het
Eif3a	A	T	19: 60,766,568	S1059T	unknown	Het
Ep300	A	G	15: 81,636,825	E1262G	unknown	Het
Evl	T	A	12: 108,686,457	I387N	probably damaging	Het
Fat2	A	C	11: 55,309,926	V774G	probably damaging	Het
Fez1	T	A	9: 36,843,797	Y31N	probably benign	Het
Fkbp10	A	G	11: 100,423,134	I435V	probably damaging	Het
Flnb	A	G	14: 7,929,004	D1911G	probably benign	Het
Fnbp1	T	C	2: 31,083,026	Y154C	probably benign	Het
Fndc10	T	C	4: 155,695,039	I180T	possibly damaging	Het
Frmd4a	G	A	2: 4,604,215	V965I	possibly damaging	Het
Gabrr2	A	G	4: 33,071,352	H64R	possibly damaging	Het
Glis3	T	C	19: 28,531,003	D527G	probably damaging	Het
Gm2022	A	T	12: 87,895,479	Q37L	possibly damaging	Het
H2-Ob	T	A	17: 34,241,015	F33L	probably damaging	Het
Hbb-bh1	C	T	7: 103,843,032	E27K	probably benign	Het
Ifnb1	T	A	4: 88,522,678	T33S	probably benign	Het
Igkv4-80	T	A	6: 69,016,782	T42S	probably damaging	Het
Irs2	C	T	8: 11,007,334	G366D	probably damaging	Het
Kcnk2	CAAA	CAA	1: 189,256,694		probably null	Het
Krtap5-3	T	A	7: 142,202,331	C302S	unknown	Het
Lgi1	A	G	19: 38,306,309	K510E	probably benign	Het
Lgi2	T	A	5: 52,538,594	D341V	probably benign	Het
Lin7c	T	C	2: 109,894,468	I14T	probably benign	Het
Lrrc19	A	T	4: 94,643,336	M13K	probably benign	Het
Lrrc69	T	C	4: 14,666,012	I315M	probably benign	Het
Myo5c	A	T	9: 75,297,488	D1541V	probably damaging	Het
Mypn	T	G	10: 63,167,240	M373L	probably benign	Het
Nckipsd	C	A	9: 108,812,638	H333N	probably damaging	Het
Olfr1367	C	A	13: 21,347,417	T163K	probably damaging	Het
Olfr235	T	C	19: 12,268,371	I47T	possibly damaging	Het
Olfr53	T	C	7: 140,651,991	L4S	probably benign	Het
Otogl	T	A	10: 107,822,033		probably null	Het
Otogl	C	T	10: 107,901,295	G86D	probably damaging	Het
Papln	A	T	12: 83,791,844	Q1249L	probably benign	Het
Plxna2	G	T	1: 194,644,894	G379C	probably damaging	Het
Pofut2	T	C	10: 77,259,426	I35T	probably benign	Het
Pros1	A	G	16: 62,924,524	T501A	possibly damaging	Het
Rapgef1	T	C	2: 29,735,809	S1042P	possibly damaging	Het
Rps6kb1	C	T	11: 86,517,617	E185K	probably damaging	Het
Slc13a2	A	T	11: 78,403,407	L216Q	probably damaging	Het
Slc22a14	T	C	9: 119,180,549	Y160C	probably damaging	Het
Slc22a4	T	A	11: 53,988,947	I429F	possibly damaging	Het
Slc26a3	A	G	12: 31,461,786	K457E	probably damaging	Het
Slc47a2	T	C	11: 61,336,234	I169M	possibly damaging	Het
Slco1a1	C	T	6: 141,908,946	V660I	probably benign	Het
Smyd1	A	G	6: 71,225,466	Y252H	probably damaging	Het
Soga3	G	A	10: 29,196,973	D754N	probably damaging	Het
Spp2	A	T	1: 88,406,973		probably benign	Het
Stra8	T	A	6: 34,934,186	W250R	probably damaging	Het
Syne1	A	C	10: 5,220,359	L5183R	probably damaging	Het
Tdrd9	T	C	12: 112,046,250	S1203P	probably damaging	Het
Th	C	A	7: 142,899,883	E27*	probably null	Het
Thada	C	A	17: 84,429,191	L887F	probably damaging	Het
Timm23	T	C	14: 32,180,629	T186A	probably benign	Het
Tmem132b	A	T	5: 125,783,356	E555V	probably damaging	Het
Tnik	A	T	3: 28,594,944	Q457L	unknown	Het
Uba7	C	A	9: 107,983,838	H942Q	probably benign	Het
Upf2	T	C	2: 5,961,267	S233P	unknown	Het
Urm1	T	A	2: 29,842,748	N72K	probably damaging	Het
Usp10	T	C	8: 119,948,765	S508P	possibly damaging	Het
Usp37	G	A	1: 74,459,922	P632S	probably damaging	Het
Wdr77	T	A	3: 105,965,088	N209K	probably benign	Het
Zbtb24	C	T	10: 41,451,433	T105M	probably benign	Het
Zfp341	T	A	2: 154,643,843	I671N	probably damaging	Het
Zfp414	A	G	17: 33,630,010	T73A	probably benign	Het
Zfp574	A	T	7: 25,081,979	I809F	possibly damaging	Het
Zfp62	T	C	11: 49,217,281	I733T	probably damaging	Het
Zfp719	A	G	7: 43,590,157	I390V	possibly damaging	Het

Other mutations in Nrg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Nrg2	APN	18	36021218	missense	probably benign	0.00
IGL01396:Nrg2	APN	18	36045852	splice site	probably benign
R0179:Nrg2	UTSW	18	36022415	missense	probably benign	0.13
R0976:Nrg2	UTSW	18	36021091	missense	probably benign	0.21
R1387:Nrg2	UTSW	18	36196739	missense	probably damaging	1.00
R1487:Nrg2	UTSW	18	36052912	missense	possibly damaging	0.69
R1746:Nrg2	UTSW	18	36021922	missense	probably damaging	1.00
R1882:Nrg2	UTSW	18	36021097	missense	probably damaging	1.00
R1940:Nrg2	UTSW	18	36196844	unclassified	probably benign
R2090:Nrg2	UTSW	18	36018443	missense	probably benign	0.00
R2183:Nrg2	UTSW	18	36196751	missense	probably benign	0.11
R4664:Nrg2	UTSW	18	36052895	missense	possibly damaging	0.87
R4677:Nrg2	UTSW	18	36021099	missense	possibly damaging	0.92
R4860:Nrg2	UTSW	18	36196547	missense	probably damaging	1.00
R4860:Nrg2	UTSW	18	36196547	missense	probably damaging	1.00
R5091:Nrg2	UTSW	18	36052785	missense	probably damaging	1.00
R6657:Nrg2	UTSW	18	36196589	missense	probably damaging	0.98
R6968:Nrg2	UTSW	18	36196446	missense	probably benign	0.01
R7186:Nrg2	UTSW	18	36045920	missense	probably benign	0.17
R7304:Nrg2	UTSW	18	36045941	missense	probably benign	0.24
R7467:Nrg2	UTSW	18	36022406	missense	probably benign	0.00
R7564:Nrg2	UTSW	18	36024396	missense	probably damaging	1.00
R7876:Nrg2	UTSW	18	36197087	missense	unknown
R8113:Nrg2	UTSW	18	36021103	missense	probably damaging	1.00
R8133:Nrg2	UTSW	18	36032377	missense	probably benign	0.00
R8214:Nrg2	UTSW	18	36196676	missense	probably benign	0.02
R8261:Nrg2	UTSW	18	36032375	missense	probably benign	0.11
R9000:Nrg2	UTSW	18	36018629	missense	probably damaging	1.00
R9131:Nrg2	UTSW	18	36024343	missense	probably damaging	1.00
R9512:Nrg2	UTSW	18	36045957	missense	probably benign	0.11
R9667:Nrg2	UTSW	18	36032377	missense	probably benign	0.09
Z1176:Nrg2	UTSW	18	36018470	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GGACAGGAAGCTGTAGTCAC -3'
(R):5'- TCCACTCATGTGCATTGGGC -3'

Sequencing Primer
(F):5'- AAGCTGTAGTCACTCATGCTGGAC -3'
(R):5'- TCTGCAAGCAGGCAAGG -3'

Posted On

2022-07-18