Incidental Mutation 'R9484:Nrg2'
ID 716487
Institutional Source Beutler Lab
Gene Symbol Nrg2
Ensembl Gene ENSMUSG00000060275
Gene Name neuregulin 2
Synonyms Don1, NTAK
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.199) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 36150705-36330433 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36157401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 428 (L428Q)
Ref Sequence ENSEMBL: ENSMUSP00000111378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115713]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000111377
Gene: ENSMUSG00000060275
AA Change: L242Q

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 1.66e-2 SMART
Pfam:Neuregulin 403 834 1.7e-79 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115713
AA Change: L428Q
SMART Domains Protein: ENSMUSP00000111378
Gene: ENSMUSG00000060275
AA Change: L428Q

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 3.76e-1 SMART
Pfam:Neuregulin 409 844 4.4e-170 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel member of the neuregulin family of growth and differentiation factors. Through interaction with the ERBB family of receptors, this protein induces the growth and differentiation of epithelial, neuronal, glial, and other types of cells. The gene consists of 12 exons and the genomic structure is similar to that of neuregulin 1, another member of the neuregulin family of ligands. The products of these genes mediate distinct biological processes by acting at different sites in tissues and eliciting different biological responses in cells. This gene is located close to the region for demyelinating Charcot-Marie-Tooth disease locus, but is not responsible for this disease. Alternative transcript variants encoding distinct isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: About one third of mice homozygous for a knock-out allele die prior to weaning in the absence of cardiac defects or other morphological abnormalities. Homozygotes display an early but transient postnatal growth deficit and reduced reproductive capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,250,845 (GRCm39) C151S probably damaging Het
Actr8 T C 14: 29,708,301 (GRCm39) I193T probably benign Het
Btbd2 T C 10: 80,480,103 (GRCm39) N419S probably benign Het
Cacna2d1 T A 5: 16,561,831 (GRCm39) W821R probably damaging Het
Cadps2 T C 6: 23,626,646 (GRCm39) Y214C probably benign Het
Calu T A 6: 29,366,162 (GRCm39) L180Q probably damaging Het
Corin C T 5: 72,497,280 (GRCm39) V615I probably damaging Het
Cyp8b1 A T 9: 121,744,983 (GRCm39) D116E probably benign Het
D630036H23Rik C A 12: 36,431,711 (GRCm39) A96S unknown Het
Ddx24 A T 12: 103,377,555 (GRCm39) Y717N probably damaging Het
Dmap1 G T 4: 117,533,308 (GRCm39) Q249K probably benign Het
Dnah10 T A 5: 124,900,508 (GRCm39) W3922R probably damaging Het
Dnah14 T C 1: 181,517,773 (GRCm39) F2036L probably benign Het
Dnah14 T C 1: 181,625,311 (GRCm39) I4064T probably benign Het
Dock9 A C 14: 121,818,844 (GRCm39) V1546G probably damaging Het
Eif1ad4 A T 12: 87,862,249 (GRCm39) Q37L possibly damaging Het
Eif3a A T 19: 60,755,006 (GRCm39) S1059T unknown Het
Ep300 A G 15: 81,521,026 (GRCm39) E1262G unknown Het
Evl T A 12: 108,652,716 (GRCm39) I387N probably damaging Het
Fat2 A C 11: 55,200,752 (GRCm39) V774G probably damaging Het
Fez1 T A 9: 36,755,093 (GRCm39) Y31N probably benign Het
Fkbp10 A G 11: 100,313,960 (GRCm39) I435V probably damaging Het
Flnb A G 14: 7,929,004 (GRCm38) D1911G probably benign Het
Fnbp1 T C 2: 30,973,038 (GRCm39) Y154C probably benign Het
Fndc10 T C 4: 155,779,496 (GRCm39) I180T possibly damaging Het
Frmd4a G A 2: 4,609,026 (GRCm39) V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 (GRCm39) H64R possibly damaging Het
Glis3 T C 19: 28,508,403 (GRCm39) D527G probably damaging Het
H2-Ob T A 17: 34,459,989 (GRCm39) F33L probably damaging Het
Hbb-bh1 C T 7: 103,492,239 (GRCm39) E27K probably benign Het
Ifnb1 T A 4: 88,440,915 (GRCm39) T33S probably benign Het
Igkv4-80 T A 6: 68,993,766 (GRCm39) T42S probably damaging Het
Irs2 C T 8: 11,057,334 (GRCm39) G366D probably damaging Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,068 (GRCm39) C302S unknown Het
Lgi1 A G 19: 38,294,757 (GRCm39) K510E probably benign Het
Lgi2 T A 5: 52,695,936 (GRCm39) D341V probably benign Het
Lin7c T C 2: 109,724,813 (GRCm39) I14T probably benign Het
Lrrc19 A T 4: 94,531,573 (GRCm39) M13K probably benign Het
Lrrc69 T C 4: 14,666,012 (GRCm39) I315M probably benign Het
Mtcl3 G A 10: 29,072,969 (GRCm39) D754N probably damaging Het
Myo5c A T 9: 75,204,770 (GRCm39) D1541V probably damaging Het
Mypn T G 10: 63,003,019 (GRCm39) M373L probably benign Het
Nckipsd C A 9: 108,689,837 (GRCm39) H333N probably damaging Het
Or13a20 T C 7: 140,231,904 (GRCm39) L4S probably benign Het
Or2b28 C A 13: 21,531,587 (GRCm39) T163K probably damaging Het
Or5an11 T C 19: 12,245,735 (GRCm39) I47T possibly damaging Het
Otogl T A 10: 107,657,894 (GRCm39) probably null Het
Otogl C T 10: 107,737,156 (GRCm39) G86D probably damaging Het
Papln A T 12: 83,838,618 (GRCm39) Q1249L probably benign Het
Plxna2 G T 1: 194,327,202 (GRCm39) G379C probably damaging Het
Pofut2 T C 10: 77,095,260 (GRCm39) I35T probably benign Het
Pros1 A G 16: 62,744,887 (GRCm39) T501A possibly damaging Het
Rapgef1 T C 2: 29,625,821 (GRCm39) S1042P possibly damaging Het
Rps6kb1 C T 11: 86,408,443 (GRCm39) E185K probably damaging Het
Slc13a2 A T 11: 78,294,233 (GRCm39) L216Q probably damaging Het
Slc22a14 T C 9: 119,009,615 (GRCm39) Y160C probably damaging Het
Slc22a4 T A 11: 53,879,773 (GRCm39) I429F possibly damaging Het
Slc26a3 A G 12: 31,511,785 (GRCm39) K457E probably damaging Het
Slc47a2 T C 11: 61,227,060 (GRCm39) I169M possibly damaging Het
Slco1a1 C T 6: 141,854,672 (GRCm39) V660I probably benign Het
Smyd1 A G 6: 71,202,450 (GRCm39) Y252H probably damaging Het
Spp2 A T 1: 88,334,695 (GRCm39) probably benign Het
Stra8 T A 6: 34,911,121 (GRCm39) W250R probably damaging Het
Syne1 A C 10: 5,170,359 (GRCm39) L5183R probably damaging Het
Tdrd9 T C 12: 112,012,684 (GRCm39) S1203P probably damaging Het
Th C A 7: 142,453,620 (GRCm39) E27* probably null Het
Thada C A 17: 84,736,619 (GRCm39) L887F probably damaging Het
Timm23 T C 14: 31,902,586 (GRCm39) T186A probably benign Het
Tmem132b A T 5: 125,860,420 (GRCm39) E555V probably damaging Het
Tnik A T 3: 28,649,093 (GRCm39) Q457L unknown Het
Uba7 C A 9: 107,861,037 (GRCm39) H942Q probably benign Het
Upf2 T C 2: 5,966,078 (GRCm39) S233P unknown Het
Urm1 T A 2: 29,732,760 (GRCm39) N72K probably damaging Het
Usp10 T C 8: 120,675,504 (GRCm39) S508P possibly damaging Het
Usp37 G A 1: 74,499,081 (GRCm39) P632S probably damaging Het
Wdr77 T A 3: 105,872,404 (GRCm39) N209K probably benign Het
Zbtb24 C T 10: 41,327,429 (GRCm39) T105M probably benign Het
Zfp341 T A 2: 154,485,763 (GRCm39) I671N probably damaging Het
Zfp414 A G 17: 33,848,984 (GRCm39) T73A probably benign Het
Zfp574 A T 7: 24,781,404 (GRCm39) I809F possibly damaging Het
Zfp62 T C 11: 49,108,108 (GRCm39) I733T probably damaging Het
Zfp719 A G 7: 43,239,581 (GRCm39) I390V possibly damaging Het
Other mutations in Nrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nrg2 APN 18 36,154,271 (GRCm39) missense probably benign 0.00
IGL01396:Nrg2 APN 18 36,178,905 (GRCm39) splice site probably benign
R0179:Nrg2 UTSW 18 36,155,468 (GRCm39) missense probably benign 0.13
R0976:Nrg2 UTSW 18 36,154,144 (GRCm39) missense probably benign 0.21
R1387:Nrg2 UTSW 18 36,329,792 (GRCm39) missense probably damaging 1.00
R1487:Nrg2 UTSW 18 36,185,965 (GRCm39) missense possibly damaging 0.69
R1746:Nrg2 UTSW 18 36,154,975 (GRCm39) missense probably damaging 1.00
R1882:Nrg2 UTSW 18 36,154,150 (GRCm39) missense probably damaging 1.00
R1940:Nrg2 UTSW 18 36,329,897 (GRCm39) unclassified probably benign
R2090:Nrg2 UTSW 18 36,151,496 (GRCm39) missense probably benign 0.00
R2183:Nrg2 UTSW 18 36,329,804 (GRCm39) missense probably benign 0.11
R4664:Nrg2 UTSW 18 36,185,948 (GRCm39) missense possibly damaging 0.87
R4677:Nrg2 UTSW 18 36,154,152 (GRCm39) missense possibly damaging 0.92
R4860:Nrg2 UTSW 18 36,329,600 (GRCm39) missense probably damaging 1.00
R4860:Nrg2 UTSW 18 36,329,600 (GRCm39) missense probably damaging 1.00
R5091:Nrg2 UTSW 18 36,185,838 (GRCm39) missense probably damaging 1.00
R6657:Nrg2 UTSW 18 36,329,642 (GRCm39) missense probably damaging 0.98
R6968:Nrg2 UTSW 18 36,329,499 (GRCm39) missense probably benign 0.01
R7186:Nrg2 UTSW 18 36,178,973 (GRCm39) missense probably benign 0.17
R7304:Nrg2 UTSW 18 36,178,994 (GRCm39) missense probably benign 0.24
R7467:Nrg2 UTSW 18 36,155,459 (GRCm39) missense probably benign 0.00
R7564:Nrg2 UTSW 18 36,157,449 (GRCm39) missense probably damaging 1.00
R7876:Nrg2 UTSW 18 36,330,140 (GRCm39) missense unknown
R8113:Nrg2 UTSW 18 36,154,156 (GRCm39) missense probably damaging 1.00
R8133:Nrg2 UTSW 18 36,165,430 (GRCm39) missense probably benign 0.00
R8214:Nrg2 UTSW 18 36,329,729 (GRCm39) missense probably benign 0.02
R8261:Nrg2 UTSW 18 36,165,428 (GRCm39) missense probably benign 0.11
R9000:Nrg2 UTSW 18 36,151,682 (GRCm39) missense probably damaging 1.00
R9131:Nrg2 UTSW 18 36,157,396 (GRCm39) missense probably damaging 1.00
R9512:Nrg2 UTSW 18 36,179,010 (GRCm39) missense probably benign 0.11
R9667:Nrg2 UTSW 18 36,165,430 (GRCm39) missense probably benign 0.09
Z1176:Nrg2 UTSW 18 36,151,523 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGACAGGAAGCTGTAGTCAC -3'
(R):5'- TCCACTCATGTGCATTGGGC -3'

Sequencing Primer
(F):5'- AAGCTGTAGTCACTCATGCTGGAC -3'
(R):5'- TCTGCAAGCAGGCAAGG -3'
Posted On 2022-07-18