Incidental Mutation 'R9484:Or5an11'
ID 716488
Institutional Source Beutler Lab
Gene Symbol Or5an11
Ensembl Gene ENSMUSG00000060049
Gene Name olfactory receptor family 5 subfamily AN member 11
Synonyms Olfr245, GA_x6K02T2LL2P-1028-792, Olfr232, GA_x6K02T03CT6-1-477, GA_x6K02T057QT-4025-4642, MOR214-3, Olfr235, MOR214-3
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 12245596-12246534 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12245735 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 47 (I47T)
Ref Sequence ENSEMBL: ENSMUSP00000146532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073507] [ENSMUST00000207969] [ENSMUST00000214551] [ENSMUST00000214613] [ENSMUST00000214638] [ENSMUST00000215407]
AlphaFold E9Q9Z6
Predicted Effect possibly damaging
Transcript: ENSMUST00000073507
AA Change: I47T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073203
Gene: ENSMUSG00000060049
AA Change: I47T

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.8e-56 PFAM
Pfam:7tm_1 42 309 1.2e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207969
AA Change: I47T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214551
AA Change: I47T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214613
AA Change: I47T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214638
AA Change: I47T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215407
AA Change: I47T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,250,845 (GRCm39) C151S probably damaging Het
Actr8 T C 14: 29,708,301 (GRCm39) I193T probably benign Het
Btbd2 T C 10: 80,480,103 (GRCm39) N419S probably benign Het
Cacna2d1 T A 5: 16,561,831 (GRCm39) W821R probably damaging Het
Cadps2 T C 6: 23,626,646 (GRCm39) Y214C probably benign Het
Calu T A 6: 29,366,162 (GRCm39) L180Q probably damaging Het
Corin C T 5: 72,497,280 (GRCm39) V615I probably damaging Het
Cyp8b1 A T 9: 121,744,983 (GRCm39) D116E probably benign Het
D630036H23Rik C A 12: 36,431,711 (GRCm39) A96S unknown Het
Ddx24 A T 12: 103,377,555 (GRCm39) Y717N probably damaging Het
Dmap1 G T 4: 117,533,308 (GRCm39) Q249K probably benign Het
Dnah10 T A 5: 124,900,508 (GRCm39) W3922R probably damaging Het
Dnah14 T C 1: 181,517,773 (GRCm39) F2036L probably benign Het
Dnah14 T C 1: 181,625,311 (GRCm39) I4064T probably benign Het
Dock9 A C 14: 121,818,844 (GRCm39) V1546G probably damaging Het
Eif1ad4 A T 12: 87,862,249 (GRCm39) Q37L possibly damaging Het
Eif3a A T 19: 60,755,006 (GRCm39) S1059T unknown Het
Ep300 A G 15: 81,521,026 (GRCm39) E1262G unknown Het
Evl T A 12: 108,652,716 (GRCm39) I387N probably damaging Het
Fat2 A C 11: 55,200,752 (GRCm39) V774G probably damaging Het
Fez1 T A 9: 36,755,093 (GRCm39) Y31N probably benign Het
Fkbp10 A G 11: 100,313,960 (GRCm39) I435V probably damaging Het
Flnb A G 14: 7,929,004 (GRCm38) D1911G probably benign Het
Fnbp1 T C 2: 30,973,038 (GRCm39) Y154C probably benign Het
Fndc10 T C 4: 155,779,496 (GRCm39) I180T possibly damaging Het
Frmd4a G A 2: 4,609,026 (GRCm39) V965I possibly damaging Het
Gabrr2 A G 4: 33,071,352 (GRCm39) H64R possibly damaging Het
Glis3 T C 19: 28,508,403 (GRCm39) D527G probably damaging Het
H2-Ob T A 17: 34,459,989 (GRCm39) F33L probably damaging Het
Hbb-bh1 C T 7: 103,492,239 (GRCm39) E27K probably benign Het
Ifnb1 T A 4: 88,440,915 (GRCm39) T33S probably benign Het
Igkv4-80 T A 6: 68,993,766 (GRCm39) T42S probably damaging Het
Irs2 C T 8: 11,057,334 (GRCm39) G366D probably damaging Het
Kcnk2 CAAA CAA 1: 188,988,891 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,068 (GRCm39) C302S unknown Het
Lgi1 A G 19: 38,294,757 (GRCm39) K510E probably benign Het
Lgi2 T A 5: 52,695,936 (GRCm39) D341V probably benign Het
Lin7c T C 2: 109,724,813 (GRCm39) I14T probably benign Het
Lrrc19 A T 4: 94,531,573 (GRCm39) M13K probably benign Het
Lrrc69 T C 4: 14,666,012 (GRCm39) I315M probably benign Het
Mtcl3 G A 10: 29,072,969 (GRCm39) D754N probably damaging Het
Myo5c A T 9: 75,204,770 (GRCm39) D1541V probably damaging Het
Mypn T G 10: 63,003,019 (GRCm39) M373L probably benign Het
Nckipsd C A 9: 108,689,837 (GRCm39) H333N probably damaging Het
Nrg2 A T 18: 36,157,401 (GRCm39) L428Q probably null Het
Or13a20 T C 7: 140,231,904 (GRCm39) L4S probably benign Het
Or2b28 C A 13: 21,531,587 (GRCm39) T163K probably damaging Het
Otogl T A 10: 107,657,894 (GRCm39) probably null Het
Otogl C T 10: 107,737,156 (GRCm39) G86D probably damaging Het
Papln A T 12: 83,838,618 (GRCm39) Q1249L probably benign Het
Plxna2 G T 1: 194,327,202 (GRCm39) G379C probably damaging Het
Pofut2 T C 10: 77,095,260 (GRCm39) I35T probably benign Het
Pros1 A G 16: 62,744,887 (GRCm39) T501A possibly damaging Het
Rapgef1 T C 2: 29,625,821 (GRCm39) S1042P possibly damaging Het
Rps6kb1 C T 11: 86,408,443 (GRCm39) E185K probably damaging Het
Slc13a2 A T 11: 78,294,233 (GRCm39) L216Q probably damaging Het
Slc22a14 T C 9: 119,009,615 (GRCm39) Y160C probably damaging Het
Slc22a4 T A 11: 53,879,773 (GRCm39) I429F possibly damaging Het
Slc26a3 A G 12: 31,511,785 (GRCm39) K457E probably damaging Het
Slc47a2 T C 11: 61,227,060 (GRCm39) I169M possibly damaging Het
Slco1a1 C T 6: 141,854,672 (GRCm39) V660I probably benign Het
Smyd1 A G 6: 71,202,450 (GRCm39) Y252H probably damaging Het
Spp2 A T 1: 88,334,695 (GRCm39) probably benign Het
Stra8 T A 6: 34,911,121 (GRCm39) W250R probably damaging Het
Syne1 A C 10: 5,170,359 (GRCm39) L5183R probably damaging Het
Tdrd9 T C 12: 112,012,684 (GRCm39) S1203P probably damaging Het
Th C A 7: 142,453,620 (GRCm39) E27* probably null Het
Thada C A 17: 84,736,619 (GRCm39) L887F probably damaging Het
Timm23 T C 14: 31,902,586 (GRCm39) T186A probably benign Het
Tmem132b A T 5: 125,860,420 (GRCm39) E555V probably damaging Het
Tnik A T 3: 28,649,093 (GRCm39) Q457L unknown Het
Uba7 C A 9: 107,861,037 (GRCm39) H942Q probably benign Het
Upf2 T C 2: 5,966,078 (GRCm39) S233P unknown Het
Urm1 T A 2: 29,732,760 (GRCm39) N72K probably damaging Het
Usp10 T C 8: 120,675,504 (GRCm39) S508P possibly damaging Het
Usp37 G A 1: 74,499,081 (GRCm39) P632S probably damaging Het
Wdr77 T A 3: 105,872,404 (GRCm39) N209K probably benign Het
Zbtb24 C T 10: 41,327,429 (GRCm39) T105M probably benign Het
Zfp341 T A 2: 154,485,763 (GRCm39) I671N probably damaging Het
Zfp414 A G 17: 33,848,984 (GRCm39) T73A probably benign Het
Zfp574 A T 7: 24,781,404 (GRCm39) I809F possibly damaging Het
Zfp62 T C 11: 49,108,108 (GRCm39) I733T probably damaging Het
Zfp719 A G 7: 43,239,581 (GRCm39) I390V possibly damaging Het
Other mutations in Or5an11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Or5an11 APN 19 12,246,374 (GRCm39) missense probably damaging 1.00
IGL03397:Or5an11 APN 19 12,245,866 (GRCm39) missense probably benign 0.03
R1239:Or5an11 UTSW 19 12,246,340 (GRCm39) missense probably damaging 1.00
R1416:Or5an11 UTSW 19 12,246,258 (GRCm39) missense probably benign 0.09
R1441:Or5an11 UTSW 19 12,245,750 (GRCm39) nonsense probably null
R1694:Or5an11 UTSW 19 12,246,281 (GRCm39) missense probably damaging 1.00
R1727:Or5an11 UTSW 19 12,246,365 (GRCm39) missense possibly damaging 0.70
R2422:Or5an11 UTSW 19 12,246,283 (GRCm39) missense probably damaging 0.99
R3439:Or5an11 UTSW 19 12,245,759 (GRCm39) missense possibly damaging 0.56
R4545:Or5an11 UTSW 19 12,246,188 (GRCm39) missense possibly damaging 0.91
R4605:Or5an11 UTSW 19 12,246,532 (GRCm39) makesense probably null
R5147:Or5an11 UTSW 19 12,246,268 (GRCm39) missense probably damaging 1.00
R5382:Or5an11 UTSW 19 12,245,773 (GRCm39) missense possibly damaging 0.62
R5717:Or5an11 UTSW 19 12,246,520 (GRCm39) missense probably benign 0.13
R6455:Or5an11 UTSW 19 12,246,070 (GRCm39) missense probably damaging 0.97
R6880:Or5an11 UTSW 19 12,245,974 (GRCm39) missense probably benign 0.22
R7311:Or5an11 UTSW 19 12,246,068 (GRCm39) missense probably benign 0.29
R7384:Or5an11 UTSW 19 12,246,440 (GRCm39) missense possibly damaging 0.80
R8138:Or5an11 UTSW 19 12,246,436 (GRCm39) missense possibly damaging 0.61
R9005:Or5an11 UTSW 19 12,245,704 (GRCm39) missense probably benign
R9118:Or5an11 UTSW 19 12,246,263 (GRCm39) missense probably benign 0.02
R9549:Or5an11 UTSW 19 12,246,408 (GRCm39) missense probably benign 0.02
R9691:Or5an11 UTSW 19 12,246,379 (GRCm39) nonsense probably null
R9738:Or5an11 UTSW 19 12,245,869 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGAGACAACAGTGCATTTTCTC -3'
(R):5'- GCAAGATTCAGTCAGCCCCATAG -3'

Sequencing Primer
(F):5'- GAGACAACAGTGCATTTTCTCATTTC -3'
(R):5'- TTCAGTCAGCCCCATAGTGGAAAG -3'
Posted On 2022-07-18