Incidental Mutation 'R9485:Ttbk2'
ID 716498
Institutional Source Beutler Lab
Gene Symbol Ttbk2
Ensembl Gene ENSMUSG00000090100
Gene Name tau tubulin kinase 2
Synonyms B930008N24Rik, 2610507N02Rik, TTK
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9485 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 120732816-120850604 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 120745505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 997 (T997N)
Ref Sequence ENSEMBL: ENSMUSP00000028740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000131389] [ENSMUST00000143051]
AlphaFold Q3UVR3
Predicted Effect probably benign
Transcript: ENSMUST00000028740
AA Change: T997N

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100
AA Change: T997N

DomainStartEndE-ValueType
Pfam:Pkinase 90 347 7e-31 PFAM
Pfam:Pkinase_Tyr 90 348 8.2e-19 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1205 1242 N/A INTRINSIC
low complexity region 1254 1271 N/A INTRINSIC
low complexity region 1285 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057135
AA Change: T928N

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100
AA Change: T928N

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085840
AA Change: T928N

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100
AA Change: T928N

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131389
SMART Domains Protein: ENSMUSP00000118905
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 145 1.3e-18 PFAM
Pfam:Pkinase_Tyr 21 148 9.7e-12 PFAM
Pfam:Pkinase 145 239 1.2e-5 PFAM
low complexity region 265 279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143051
SMART Domains Protein: ENSMUSP00000121996
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 2.4e-32 PFAM
Pfam:Pkinase_Tyr 21 280 7.7e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit complete preweaning lethality, decreased embryo size, growth retardation, and incomplete turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik T C 1: 177,752,979 V130A possibly damaging Het
3425401B19Rik T C 14: 32,661,443 D855G possibly damaging Het
4930486L24Rik A T 13: 60,853,245 V159D possibly damaging Het
Ahnak G A 19: 9,002,074 A241T probably benign Het
Apoa4 T C 9: 46,241,155 M1T probably null Het
Atn1 T C 6: 124,745,785 K776E unknown Het
Atp1a2 A G 1: 172,278,255 *948R probably null Het
Atp7b T C 8: 22,012,762 Q801R probably damaging Het
Birc6 T A 17: 74,638,403 S2824T probably damaging Het
Cacng3 A T 7: 122,762,212 I109F probably damaging Het
Cass4 T C 2: 172,427,885 F629S probably benign Het
Cnot6l T C 5: 96,082,999 T370A probably damaging Het
Cntnap5c A C 17: 58,102,108 D447A probably damaging Het
Col11a2 T A 17: 34,039,695 L14Q unknown Het
Dennd4a T G 9: 64,907,106 Y1505* probably null Het
Dhx32 T C 7: 133,725,381 M464V possibly damaging Het
Diexf C A 1: 193,130,233 probably benign Het
Dip2b T C 15: 100,155,043 V266A probably benign Het
Dnajb6 C T 5: 29,781,519 Q220* probably null Het
Dnmt3a G A 12: 3,866,121 S102N probably benign Het
Dph5 A T 3: 115,888,328 probably benign Het
Ear6 T A 14: 51,854,032 L12H Het
Erp27 T C 6: 136,909,550 T162A possibly damaging Het
Fance T A 17: 28,317,505 L13H probably damaging Het
Fanci T A 7: 79,439,657 V947D probably benign Het
Gab1 G A 8: 80,788,855 T278M probably damaging Het
Gbp4 A T 5: 105,121,930 M344K probably damaging Het
Gm8251 T G 1: 44,056,239 K1900Q possibly damaging Het
Gpr87 C T 3: 59,179,584 V167M possibly damaging Het
Gramd1a T G 7: 31,130,538 D708A unknown Het
Gzmd T A 14: 56,130,703 I100F probably benign Het
Hcrtr1 T A 4: 130,137,261 M77L possibly damaging Het
Hipk2 C A 6: 38,703,510 R965L possibly damaging Het
Ift88 T C 14: 57,438,267 M79T probably benign Het
Ighv1-12 T C 12: 114,615,905 Y99C possibly damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Iltifb A G 10: 118,294,409 V63A probably benign Het
Mllt1 C T 17: 56,900,184 R220H probably damaging Het
Mroh8 T C 2: 157,229,993 T531A probably benign Het
Myh6 T C 14: 54,944,345 K1833R probably benign Het
Nfkbie C T 17: 45,560,427 T270I probably damaging Het
Olfr1215 G A 2: 89,001,365 P308S unknown Het
Olfr549 A T 7: 102,554,806 N174I probably damaging Het
Olfr678 C T 7: 105,069,496 H10Y possibly damaging Het
Pcdh8 A T 14: 79,768,249 F900I probably damaging Het
Pcolce2 T A 9: 95,638,667 C32* probably null Het
Pus7 A T 5: 23,768,861 S212T probably benign Het
Rgs12 G T 5: 35,032,270 W1322L probably damaging Het
Sec1 G A 7: 45,678,609 T338I probably damaging Het
Slc25a36 T C 9: 97,080,469 K156E probably benign Het
Snrpn C T 7: 59,987,464 D35N probably damaging Het
Sox9 A G 11: 112,782,879 S99G probably benign Het
Tacc3 T C 5: 33,664,300 S135P possibly damaging Het
Taf2 T C 15: 55,048,271 E583G probably benign Het
Tmprss7 T A 16: 45,677,919 K366* probably null Het
Trpm6 G T 19: 18,778,614 V74L probably benign Het
Vmn2r3 T A 3: 64,275,625 I218F probably damaging Het
Vps50 T C 6: 3,592,557 V730A probably damaging Het
Wdr47 A T 3: 108,637,055 I665F probably damaging Het
Wnt7a T A 6: 91,366,315 N195I probably benign Het
Zfp131 A G 13: 119,790,349 probably benign Het
Zfp709 T A 8: 71,889,825 V366E possibly damaging Het
Zfp985 T A 4: 147,583,823 C383S probably damaging Het
Other mutations in Ttbk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ttbk2 APN 2 120748833 nonsense probably null
IGL00484:Ttbk2 APN 2 120773886 nonsense probably null
IGL00767:Ttbk2 APN 2 120745745 missense probably benign
IGL00809:Ttbk2 APN 2 120760269 missense probably damaging 1.00
IGL01484:Ttbk2 APN 2 120739833 missense possibly damaging 0.95
IGL01974:Ttbk2 APN 2 120786083 missense probably damaging 1.00
IGL02488:Ttbk2 APN 2 120755871 missense probably benign 0.00
IGL02874:Ttbk2 APN 2 120745712 missense probably damaging 0.99
IGL02893:Ttbk2 APN 2 120783729 missense probably damaging 1.00
IGL03210:Ttbk2 APN 2 120822492 missense probably damaging 0.99
R0279:Ttbk2 UTSW 2 120748960 missense probably benign 0.00
R0362:Ttbk2 UTSW 2 120745783 missense possibly damaging 0.90
R0376:Ttbk2 UTSW 2 120777581 missense probably damaging 1.00
R0400:Ttbk2 UTSW 2 120750242 missense probably benign 0.02
R0601:Ttbk2 UTSW 2 120825296 missense possibly damaging 0.73
R0606:Ttbk2 UTSW 2 120773872 missense probably damaging 1.00
R0664:Ttbk2 UTSW 2 120748821 missense probably damaging 0.99
R0718:Ttbk2 UTSW 2 120745160 missense probably benign 0.00
R0718:Ttbk2 UTSW 2 120748575 missense probably benign 0.01
R0783:Ttbk2 UTSW 2 120739977 missense possibly damaging 0.74
R0906:Ttbk2 UTSW 2 120783781 missense probably damaging 1.00
R1141:Ttbk2 UTSW 2 120806851 missense probably damaging 1.00
R1363:Ttbk2 UTSW 2 120806908 critical splice acceptor site probably null
R1420:Ttbk2 UTSW 2 120745912 missense probably benign 0.00
R1734:Ttbk2 UTSW 2 120755838 missense probably benign 0.01
R2033:Ttbk2 UTSW 2 120806849 missense probably damaging 0.98
R2047:Ttbk2 UTSW 2 120748916 missense probably damaging 0.99
R2893:Ttbk2 UTSW 2 120745610 splice site probably null
R3783:Ttbk2 UTSW 2 120773815 splice site probably benign
R3785:Ttbk2 UTSW 2 120773815 splice site probably benign
R3870:Ttbk2 UTSW 2 120740019 missense probably damaging 1.00
R4024:Ttbk2 UTSW 2 120760255 missense possibly damaging 0.91
R4039:Ttbk2 UTSW 2 120745795 missense probably benign 0.01
R4060:Ttbk2 UTSW 2 120748984 missense probably benign 0.26
R4624:Ttbk2 UTSW 2 120773323 missense probably benign 0.19
R4634:Ttbk2 UTSW 2 120740192 missense probably damaging 1.00
R4708:Ttbk2 UTSW 2 120739861 missense probably damaging 1.00
R4727:Ttbk2 UTSW 2 120745370 missense probably benign 0.01
R4811:Ttbk2 UTSW 2 120740070 missense possibly damaging 0.62
R4962:Ttbk2 UTSW 2 120745150 missense probably damaging 1.00
R4964:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R4966:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R5369:Ttbk2 UTSW 2 120825262 start gained probably benign
R5430:Ttbk2 UTSW 2 120777565 missense probably damaging 1.00
R5607:Ttbk2 UTSW 2 120806824 missense possibly damaging 0.89
R5812:Ttbk2 UTSW 2 120822559 missense probably damaging 0.99
R5898:Ttbk2 UTSW 2 120745040 missense probably benign 0.08
R5951:Ttbk2 UTSW 2 120773283 missense probably benign 0.02
R6135:Ttbk2 UTSW 2 120750317 missense probably damaging 1.00
R6889:Ttbk2 UTSW 2 120773353 missense probably damaging 1.00
R6907:Ttbk2 UTSW 2 120825270 missense probably benign 0.00
R7013:Ttbk2 UTSW 2 120745784 missense possibly damaging 0.89
R7128:Ttbk2 UTSW 2 120746088 missense probably benign 0.00
R7173:Ttbk2 UTSW 2 120740111 missense probably damaging 1.00
R7358:Ttbk2 UTSW 2 120790310 missense probably damaging 1.00
R7475:Ttbk2 UTSW 2 120748640 missense probably benign 0.01
R7891:Ttbk2 UTSW 2 120786029 missense probably damaging 1.00
R8529:Ttbk2 UTSW 2 120773857 missense possibly damaging 0.67
R9050:Ttbk2 UTSW 2 120806838 missense probably benign 0.09
R9051:Ttbk2 UTSW 2 120745430 nonsense probably null
R9372:Ttbk2 UTSW 2 120773285 missense probably benign 0.31
RF010:Ttbk2 UTSW 2 120790339 nonsense probably null
RF021:Ttbk2 UTSW 2 120748634 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCCCAGGAAAGACTTGAACTGC -3'
(R):5'- TTGACCCACATGCTGAAGGG -3'

Sequencing Primer
(F):5'- GGCTGATAGGCTTTCTTCT -3'
(R):5'- CCAGATGGCAGCAATGCAG -3'
Posted On 2022-07-18