Incidental Mutation 'R9485:Dennd4a'
ID 716530
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene Name DENN/MADD domain containing 4A
Synonyms F730015K02Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock # R9485 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 64811340-64919667 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 64907106 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1505 (Y1505*)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
AlphaFold E9Q8V6
Predicted Effect probably null
Transcript: ENSMUST00000038890
AA Change: Y1505*
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: Y1505*

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik T C 1: 177,752,979 V130A possibly damaging Het
3425401B19Rik T C 14: 32,661,443 D855G possibly damaging Het
4930486L24Rik A T 13: 60,853,245 V159D possibly damaging Het
Ahnak G A 19: 9,002,074 A241T probably benign Het
Apoa4 T C 9: 46,241,155 M1T probably null Het
Atn1 T C 6: 124,745,785 K776E unknown Het
Atp1a2 A G 1: 172,278,255 *948R probably null Het
Atp7b T C 8: 22,012,762 Q801R probably damaging Het
Birc6 T A 17: 74,638,403 S2824T probably damaging Het
Cacng3 A T 7: 122,762,212 I109F probably damaging Het
Cass4 T C 2: 172,427,885 F629S probably benign Het
Cnot6l T C 5: 96,082,999 T370A probably damaging Het
Cntnap5c A C 17: 58,102,108 D447A probably damaging Het
Col11a2 T A 17: 34,039,695 L14Q unknown Het
Dhx32 T C 7: 133,725,381 M464V possibly damaging Het
Diexf C A 1: 193,130,233 probably benign Het
Dip2b T C 15: 100,155,043 V266A probably benign Het
Dnajb6 C T 5: 29,781,519 Q220* probably null Het
Dnmt3a G A 12: 3,866,121 S102N probably benign Het
Dph5 A T 3: 115,888,328 probably benign Het
Ear6 T A 14: 51,854,032 L12H Het
Erp27 T C 6: 136,909,550 T162A possibly damaging Het
Fance T A 17: 28,317,505 L13H probably damaging Het
Fanci T A 7: 79,439,657 V947D probably benign Het
Gab1 G A 8: 80,788,855 T278M probably damaging Het
Gbp4 A T 5: 105,121,930 M344K probably damaging Het
Gm8251 T G 1: 44,056,239 K1900Q possibly damaging Het
Gpr87 C T 3: 59,179,584 V167M possibly damaging Het
Gramd1a T G 7: 31,130,538 D708A unknown Het
Gzmd T A 14: 56,130,703 I100F probably benign Het
Hcrtr1 T A 4: 130,137,261 M77L possibly damaging Het
Hipk2 C A 6: 38,703,510 R965L possibly damaging Het
Ift88 T C 14: 57,438,267 M79T probably benign Het
Ighv1-12 T C 12: 114,615,905 Y99C possibly damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Iltifb A G 10: 118,294,409 V63A probably benign Het
Mllt1 C T 17: 56,900,184 R220H probably damaging Het
Mroh8 T C 2: 157,229,993 T531A probably benign Het
Myh6 T C 14: 54,944,345 K1833R probably benign Het
Nfkbie C T 17: 45,560,427 T270I probably damaging Het
Olfr1215 G A 2: 89,001,365 P308S unknown Het
Olfr549 A T 7: 102,554,806 N174I probably damaging Het
Olfr678 C T 7: 105,069,496 H10Y possibly damaging Het
Pcdh8 A T 14: 79,768,249 F900I probably damaging Het
Pcolce2 T A 9: 95,638,667 C32* probably null Het
Pus7 A T 5: 23,768,861 S212T probably benign Het
Rgs12 G T 5: 35,032,270 W1322L probably damaging Het
Sec1 G A 7: 45,678,609 T338I probably damaging Het
Slc25a36 T C 9: 97,080,469 K156E probably benign Het
Snrpn C T 7: 59,987,464 D35N probably damaging Het
Sox9 A G 11: 112,782,879 S99G probably benign Het
Tacc3 T C 5: 33,664,300 S135P possibly damaging Het
Taf2 T C 15: 55,048,271 E583G probably benign Het
Tmprss7 T A 16: 45,677,919 K366* probably null Het
Trpm6 G T 19: 18,778,614 V74L probably benign Het
Ttbk2 G T 2: 120,745,505 T997N probably benign Het
Vmn2r3 T A 3: 64,275,625 I218F probably damaging Het
Vps50 T C 6: 3,592,557 V730A probably damaging Het
Wdr47 A T 3: 108,637,055 I665F probably damaging Het
Wnt7a T A 6: 91,366,315 N195I probably benign Het
Zfp131 A G 13: 119,790,349 probably benign Het
Zfp709 T A 8: 71,889,825 V366E possibly damaging Het
Zfp985 T A 4: 147,583,823 C383S probably damaging Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64911762 missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64906884 missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64842621 missense probably benign 0.00
IGL01827:Dennd4a APN 9 64842561 nonsense probably null
IGL01828:Dennd4a APN 9 64842561 nonsense probably null
IGL01829:Dennd4a APN 9 64842561 nonsense probably null
IGL01979:Dennd4a APN 9 64894409 missense probably benign 0.00
IGL02100:Dennd4a APN 9 64909706 splice site probably benign
IGL02339:Dennd4a APN 9 64842561 nonsense probably null
IGL02341:Dennd4a APN 9 64842561 nonsense probably null
IGL02584:Dennd4a APN 9 64851298 missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64862327 missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64910191 splice site probably benign
IGL02701:Dennd4a APN 9 64897353 missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64862414 missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64871874 missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64888526 missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64888974 missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64871882 missense probably benign 0.32
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0129:Dennd4a UTSW 9 64893294 missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64852445 missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64862391 missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64851383 critical splice donor site probably null
R1225:Dennd4a UTSW 9 64911675 missense probably benign 0.03
R1311:Dennd4a UTSW 9 64910004 missense probably benign 0.34
R1448:Dennd4a UTSW 9 64906045 missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64911665 missense probably benign 0.03
R1630:Dennd4a UTSW 9 64871882 missense probably benign 0.32
R1709:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64859358 critical splice donor site probably null
R1851:Dennd4a UTSW 9 64862030 missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64897234 missense probably benign 0.00
R1900:Dennd4a UTSW 9 64897336 missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64889086 missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64842490 missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R1955:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R2049:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64905974 splice site probably null
R2138:Dennd4a UTSW 9 64889337 missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64852417 missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64906081 missense probably benign 0.03
R3108:Dennd4a UTSW 9 64912387 missense probably benign 0.23
R3176:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64872028 missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64852575 missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64862331 missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64911892 missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64894407 missense probably benign
R4701:Dennd4a UTSW 9 64897357 missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64897249 missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64889056 missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64896590 missense probably benign
R4881:Dennd4a UTSW 9 64838844 missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64906003 missense probably benign 0.00
R5225:Dennd4a UTSW 9 64888928 missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64904227 missense probably benign 0.07
R5649:Dennd4a UTSW 9 64851209 splice site probably null
R5868:Dennd4a UTSW 9 64896729 missense probably benign 0.02
R5876:Dennd4a UTSW 9 64911755 missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64886945 missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64871899 missense probably benign 0.04
R6596:Dennd4a UTSW 9 64852420 missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64886965 missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64852489 nonsense probably null
R7056:Dennd4a UTSW 9 64906923 missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64894399 missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64896474 missense probably benign 0.05
R7238:Dennd4a UTSW 9 64861956 missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64897269 missense probably benign 0.01
R7454:Dennd4a UTSW 9 64852570 missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64873044 missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64888587 missense probably benign 0.01
R7662:Dennd4a UTSW 9 64852431 missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64906920 missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64872993 critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64852512 missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64873030 missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64888568 missense probably benign 0.01
R8089:Dennd4a UTSW 9 64849175 missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64906875 missense probably benign 0.00
R8397:Dennd4a UTSW 9 64889109 missense probably benign
R8425:Dennd4a UTSW 9 64838974 missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64886879 missense probably damaging 1.00
R8855:Dennd4a UTSW 9 64912390 missense probably benign
R9219:Dennd4a UTSW 9 64889094 missense probably damaging 0.96
R9275:Dennd4a UTSW 9 64842624 missense probably damaging 1.00
R9376:Dennd4a UTSW 9 64912692 missense probably benign 0.00
X0026:Dennd4a UTSW 9 64897320 missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64872022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATCATGGCTGGCTGGAC -3'
(R):5'- CACTCAGTGATTAATTACAGGAACG -3'

Sequencing Primer
(F):5'- CTGGACAGCAGATGATTCAAATCTC -3'
(R):5'- ACAGGAACGTATATTTTCACAGAAAC -3'
Posted On 2022-07-18