Incidental Mutation 'R9485:Dip2b'
ID 716546
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock # R9485 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 100038664-100219473 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100155043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 266 (V266A)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
AA Change: V33A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: V33A

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: V266A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: V266A

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik T C 1: 177,752,979 V130A possibly damaging Het
3425401B19Rik T C 14: 32,661,443 D855G possibly damaging Het
4930486L24Rik A T 13: 60,853,245 V159D possibly damaging Het
Ahnak G A 19: 9,002,074 A241T probably benign Het
Apoa4 T C 9: 46,241,155 M1T probably null Het
Atn1 T C 6: 124,745,785 K776E unknown Het
Atp1a2 A G 1: 172,278,255 *948R probably null Het
Atp7b T C 8: 22,012,762 Q801R probably damaging Het
Birc6 T A 17: 74,638,403 S2824T probably damaging Het
Cacng3 A T 7: 122,762,212 I109F probably damaging Het
Cass4 T C 2: 172,427,885 F629S probably benign Het
Cnot6l T C 5: 96,082,999 T370A probably damaging Het
Cntnap5c A C 17: 58,102,108 D447A probably damaging Het
Col11a2 T A 17: 34,039,695 L14Q unknown Het
Dennd4a T G 9: 64,907,106 Y1505* probably null Het
Dhx32 T C 7: 133,725,381 M464V possibly damaging Het
Diexf C A 1: 193,130,233 probably benign Het
Dnajb6 C T 5: 29,781,519 Q220* probably null Het
Dnmt3a G A 12: 3,866,121 S102N probably benign Het
Dph5 A T 3: 115,888,328 probably benign Het
Ear6 T A 14: 51,854,032 L12H Het
Erp27 T C 6: 136,909,550 T162A possibly damaging Het
Fance T A 17: 28,317,505 L13H probably damaging Het
Fanci T A 7: 79,439,657 V947D probably benign Het
Gab1 G A 8: 80,788,855 T278M probably damaging Het
Gbp4 A T 5: 105,121,930 M344K probably damaging Het
Gm8251 T G 1: 44,056,239 K1900Q possibly damaging Het
Gpr87 C T 3: 59,179,584 V167M possibly damaging Het
Gramd1a T G 7: 31,130,538 D708A unknown Het
Gzmd T A 14: 56,130,703 I100F probably benign Het
Hcrtr1 T A 4: 130,137,261 M77L possibly damaging Het
Hipk2 C A 6: 38,703,510 R965L possibly damaging Het
Ift88 T C 14: 57,438,267 M79T probably benign Het
Ighv1-12 T C 12: 114,615,905 Y99C possibly damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Iltifb A G 10: 118,294,409 V63A probably benign Het
Mllt1 C T 17: 56,900,184 R220H probably damaging Het
Mroh8 T C 2: 157,229,993 T531A probably benign Het
Myh6 T C 14: 54,944,345 K1833R probably benign Het
Nfkbie C T 17: 45,560,427 T270I probably damaging Het
Olfr1215 G A 2: 89,001,365 P308S unknown Het
Olfr549 A T 7: 102,554,806 N174I probably damaging Het
Olfr678 C T 7: 105,069,496 H10Y possibly damaging Het
Pcdh8 A T 14: 79,768,249 F900I probably damaging Het
Pcolce2 T A 9: 95,638,667 C32* probably null Het
Pus7 A T 5: 23,768,861 S212T probably benign Het
Rgs12 G T 5: 35,032,270 W1322L probably damaging Het
Sec1 G A 7: 45,678,609 T338I probably damaging Het
Slc25a36 T C 9: 97,080,469 K156E probably benign Het
Snrpn C T 7: 59,987,464 D35N probably damaging Het
Sox9 A G 11: 112,782,879 S99G probably benign Het
Tacc3 T C 5: 33,664,300 S135P possibly damaging Het
Taf2 T C 15: 55,048,271 E583G probably benign Het
Tmprss7 T A 16: 45,677,919 K366* probably null Het
Trpm6 G T 19: 18,778,614 V74L probably benign Het
Ttbk2 G T 2: 120,745,505 T997N probably benign Het
Vmn2r3 T A 3: 64,275,625 I218F probably damaging Het
Vps50 T C 6: 3,592,557 V730A probably damaging Het
Wdr47 A T 3: 108,637,055 I665F probably damaging Het
Wnt7a T A 6: 91,366,315 N195I probably benign Het
Zfp131 A G 13: 119,790,349 probably benign Het
Zfp709 T A 8: 71,889,825 V366E possibly damaging Het
Zfp985 T A 4: 147,583,823 C383S probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 splice site probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 splice site probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 splice site probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
R7002:Dip2b UTSW 15 100160465 missense probably benign 0.43
R7076:Dip2b UTSW 15 100157972 splice site probably null
R7176:Dip2b UTSW 15 100169318 missense probably damaging 1.00
R7255:Dip2b UTSW 15 100209627 missense probably benign 0.00
R7463:Dip2b UTSW 15 100154157 missense probably benign
R7513:Dip2b UTSW 15 100207748 splice site probably null
R7876:Dip2b UTSW 15 100191041 missense probably benign 0.02
R8368:Dip2b UTSW 15 100154243 missense probably benign 0.00
R9289:Dip2b UTSW 15 100173271 missense probably damaging 0.97
R9405:Dip2b UTSW 15 100195876 missense probably benign 0.05
R9477:Dip2b UTSW 15 100038903 missense probably damaging 1.00
R9533:Dip2b UTSW 15 100175297 missense probably benign 0.06
R9581:Dip2b UTSW 15 100181374 missense probably damaging 0.99
R9666:Dip2b UTSW 15 100209580 missense probably damaging 1.00
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATCTGTACCTTAAACGTTTC -3'
(R):5'- TAGCGACATGAAGCCCTTTC -3'

Sequencing Primer
(F):5'- GGGCATCAGTTCCCATTACAGATG -3'
(R):5'- ACTTCTGATGAGTGCGTG -3'
Posted On 2022-07-18