Incidental Mutation 'R9486:Scn11a'
ID 716593
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9486 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 119624774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 516 (H516P)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect possibly damaging
Transcript: ENSMUST00000070617
AA Change: H516P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: H516P

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000215718
AA Change: H516P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,546,942 (GRCm39) F396L probably damaging Het
Abca13 T C 11: 9,240,621 (GRCm39) I828T possibly damaging Het
Ace3 A T 11: 105,896,219 (GRCm39) T722S probably benign Het
Acot2 A G 12: 84,039,426 (GRCm39) T312A probably benign Het
Adra2a A G 19: 54,035,963 (GRCm39) I440V probably damaging Het
Arhgap22 T A 14: 33,073,303 (GRCm39) M4K probably benign Het
Atp8b3 C T 10: 80,366,821 (GRCm39) C259Y probably damaging Het
Bcl2 T A 1: 106,471,109 (GRCm39) Y199F probably benign Het
Brca1 A T 11: 101,414,520 (GRCm39) C1205S probably benign Het
Col7a1 T C 9: 108,811,396 (GRCm39) V2743A unknown Het
Crybg1 A G 10: 43,880,145 (GRCm39) probably benign Het
Cyp2c40 T A 19: 39,755,808 (GRCm39) H502L probably benign Het
Cyp2c40 A T 19: 39,796,050 (GRCm39) Y109* probably null Het
Cyp4a29 T C 4: 115,106,916 (GRCm39) M191T probably damaging Het
Dcaf1 A G 9: 106,735,916 (GRCm39) R955G possibly damaging Het
Dcaf4 G T 12: 83,582,726 (GRCm39) A274S probably damaging Het
Dlx1 A G 2: 71,362,828 (GRCm39) H245R probably damaging Het
Dnah14 A G 1: 181,508,494 (GRCm39) N1891D possibly damaging Het
Dock10 A T 1: 80,479,452 (GRCm39) V2167D unknown Het
Epyc A G 10: 97,511,697 (GRCm39) Q230R probably benign Het
Etnk1 G A 6: 143,130,310 (GRCm39) R143H probably damaging Het
Fhip2b T C 14: 70,826,479 (GRCm39) D203G probably benign Het
Fmo2 T C 1: 162,708,292 (GRCm39) E281G probably damaging Het
Gm2042 T A 12: 87,925,963 (GRCm39) Y304N possibly damaging Het
Hecw2 T C 1: 53,852,466 (GRCm39) D1551G probably damaging Het
Hgd A T 16: 37,413,811 (GRCm39) D91V probably benign Het
Hspa12a A G 19: 58,797,891 (GRCm39) F276L probably benign Het
Ifitm10 C T 7: 141,909,812 (GRCm39) V95M probably damaging Het
Ints3 G A 3: 90,313,579 (GRCm39) R350* probably null Het
Kdm4c T A 4: 74,252,966 (GRCm39) I511K probably benign Het
Kif27 A G 13: 58,492,348 (GRCm39) S264P probably damaging Het
L1td1 A G 4: 98,624,899 (GRCm39) T365A probably benign Het
Ltbp2 T A 12: 84,878,648 (GRCm39) T304S possibly damaging Het
Mamdc4 T A 2: 25,455,164 (GRCm39) Y962F probably benign Het
Map3k4 C T 17: 12,489,860 (GRCm39) A524T probably damaging Het
Mfsd8 C T 3: 40,789,627 (GRCm39) R140H probably damaging Het
Mmp3 A G 9: 7,451,256 (GRCm39) I331V possibly damaging Het
Mpdz T A 4: 81,254,043 (GRCm39) I1030F probably damaging Het
Mtx1 A T 3: 89,120,163 (GRCm39) C62S Het
Muc20 A T 16: 32,615,248 (GRCm39) V43E possibly damaging Het
Naa25 A G 5: 121,577,958 (GRCm39) E955G probably damaging Het
Nelfcd A G 2: 174,268,635 (GRCm39) Y562C probably damaging Het
Nsd2 T A 5: 34,018,493 (GRCm39) M509K probably benign Het
Obscn T C 11: 58,918,272 (GRCm39) T207A Het
Or1ad1 T A 11: 50,875,691 (GRCm39) H54Q possibly damaging Het
Or4a39 C T 2: 89,236,959 (GRCm39) V155M possibly damaging Het
Or4k5 T A 14: 50,385,672 (GRCm39) I220L probably benign Het
Osbpl11 A T 16: 33,006,283 (GRCm39) N37I possibly damaging Het
Pcdh9 A G 14: 93,797,956 (GRCm39) S1032P possibly damaging Het
Pde6b T A 5: 108,551,241 (GRCm39) I175N probably damaging Het
Pfkl T A 10: 77,824,184 (GRCm39) M735L probably benign Het
Pkp4 T C 2: 59,138,722 (GRCm39) V324A probably benign Het
Ptprb T A 10: 116,155,494 (GRCm39) C462* probably null Het
Rasal3 T C 17: 32,617,910 (GRCm39) N221S probably benign Het
Reep1 A T 6: 71,684,969 (GRCm39) I6F probably benign Het
Rhobtb1 T A 10: 69,106,621 (GRCm39) F457L probably damaging Het
Ryr1 T C 7: 28,777,965 (GRCm39) N2184S probably benign Het
Sipa1l1 T C 12: 82,404,139 (GRCm39) probably null Het
Slc17a7 A G 7: 44,821,606 (GRCm39) N381S possibly damaging Het
Slc38a3 C T 9: 107,536,322 (GRCm39) V25M probably benign Het
Spag1 T G 15: 36,181,954 (GRCm39) D37E probably damaging Het
Spib G T 7: 44,178,815 (GRCm39) D114E possibly damaging Het
Tpx2 A T 2: 152,726,933 (GRCm39) Y400F probably damaging Het
Trhde A G 10: 114,532,014 (GRCm39) I362T possibly damaging Het
Usp17ld C T 7: 102,899,381 (GRCm39) G517E probably benign Het
Vmn1r22 A T 6: 57,877,404 (GRCm39) M191K probably damaging Het
Wdr6 G A 9: 108,453,182 (GRCm39) R234C probably damaging Het
Zdhhc22 C T 12: 87,030,398 (GRCm39) M183I probably benign Het
Zfp1007 C A 5: 109,824,062 (GRCm39) G463* probably null Het
Zfp949 C A 9: 88,452,182 (GRCm39) T584N probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTTTGAAAGATAGCACAGTGGG -3'
(R):5'- GCCTGATCCGCCATTATGAC -3'

Sequencing Primer
(F):5'- GGTGGTCCCAGGAAACTTC -3'
(R):5'- GGACCTCTCCGTATAAAGTGC -3'
Posted On 2022-07-18