Incidental Mutation 'R9487:Aqr'
ID 716644
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Name aquarius
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 114101170-114187024 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114104047 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1371 (N1371S)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
AlphaFold Q8CFQ3
Predicted Effect probably benign
Transcript: ENSMUST00000043160
AA Change: N1371S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: N1371S

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102543
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik C T 1: 53,182,506 D55N possibly damaging Het
Abcc2 G A 19: 43,818,032 G762S probably damaging Het
Acta2 C A 19: 34,248,465 A110S probably damaging Het
Adam26a T C 8: 43,569,419 T345A possibly damaging Het
Anapc11 T C 11: 120,605,424 *85R probably null Het
Ang2 A C 14: 51,195,614 C104G probably damaging Het
Ankzf1 G A 1: 75,197,952 V529I probably benign Het
Aox4 G T 1: 58,248,938 V737F probably benign Het
Bach1 T A 16: 87,729,845 S732T probably benign Het
Bcr T A 10: 75,131,599 I555N probably damaging Het
Bicra T C 7: 15,971,792 T1575A probably damaging Het
Bop1 A G 15: 76,453,876 L598P probably damaging Het
Cacna1d A T 14: 30,123,462 F605L possibly damaging Het
Capn15 C T 17: 25,965,379 V109I possibly damaging Het
Cdkn1b T C 6: 134,920,852 probably benign Het
Dnah2 T C 11: 69,515,791 T542A possibly damaging Het
Dsc2 A T 18: 20,047,219 I159N probably damaging Het
Ecel1 A T 1: 87,147,994 V774E probably damaging Het
Eif5b T A 1: 38,019,370 L251* probably null Het
Eif5b T G 1: 38,045,479 C849W probably damaging Het
Ext2 T C 2: 93,762,611 D416G probably damaging Het
Fancm G A 12: 65,106,614 W1281* probably null Het
Flvcr1 A T 1: 191,011,632 I409K possibly damaging Het
Foxk1 T C 5: 142,451,634 probably null Het
Frem2 T A 3: 53,653,484 I1201F possibly damaging Het
Gabra5 A G 7: 57,508,125 probably benign Het
Gm340 C A 19: 41,585,246 N813K probably damaging Het
Gmpr2 G A 14: 55,678,321 V319I probably damaging Het
Gna12 A T 5: 140,760,583 L369Q probably damaging Het
Gpr160 A G 3: 30,896,765 R329G probably benign Het
H2-M10.3 T C 17: 36,366,531 H285R probably benign Het
H2-M2 A T 17: 37,482,533 V194E probably benign Het
Hephl1 G A 9: 15,084,534 R431W possibly damaging Het
Hr A G 14: 70,556,437 T46A probably benign Het
Hr A G 14: 70,556,765 H126R possibly damaging Het
Hsf1 T G 15: 76,498,198 D256E probably benign Het
Ifi208 C T 1: 173,683,395 T372I probably damaging Het
Ifi47 T G 11: 49,095,793 F129C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Itga11 A T 9: 62,762,889 N765I probably benign Het
Klhl22 T A 16: 17,771,799 I108K probably benign Het
Lancl1 T G 1: 67,034,222 H34P probably benign Het
Lrmp A G 6: 145,174,531 I491V probably benign Het
Mbd3l1 G A 9: 18,484,978 G133D probably benign Het
Med12l T C 3: 59,247,932 F1178L probably benign Het
Mrm1 A T 11: 84,814,705 N289K probably damaging Het
Myf6 A G 10: 107,494,212 Y165H probably benign Het
Myo1g C A 11: 6,506,913 C971F probably benign Het
Myo3a T C 2: 22,241,051 M3T probably benign Het
Nsrp1 G A 11: 77,046,288 R361* probably null Het
Olfr1055 T A 2: 86,347,502 D88V probably benign Het
Olfr1241 T C 2: 89,482,412 H241R probably damaging Het
Olfr1250 T C 2: 89,657,387 D18G probably damaging Het
Olfr478 A T 7: 108,031,956 I129N possibly damaging Het
Olfr55 C A 17: 33,176,574 H57Q possibly damaging Het
Olfr890 G A 9: 38,143,570 C140Y probably benign Het
Olfr963 A C 9: 39,669,315 Q86P possibly damaging Het
Oscar T G 7: 3,611,664 Y103S probably damaging Het
Pdpr A G 8: 111,126,293 N610S probably benign Het
Ppp4r3b T C 11: 29,174,697 I56T probably damaging Het
Pxdn T A 12: 29,994,553 V510D possibly damaging Het
Rab11fip5 T C 6: 85,347,931 S465G possibly damaging Het
Rasgrf2 T C 13: 92,131,251 T82A probably benign Het
Scmh1 G A 4: 120,463,087 W30* probably null Het
Sema4g T C 19: 44,992,632 Y40H probably benign Het
Serpinf2 A T 11: 75,432,668 M404K probably damaging Het
Sgk3 T C 1: 9,880,391 probably null Het
Slc16a5 A T 11: 115,469,912 Y307F possibly damaging Het
Slc39a5 G A 10: 128,397,759 L290F probably damaging Het
Snx32 A C 19: 5,497,708 D191E probably damaging Het
Sp4 T C 12: 118,299,124 I396V probably benign Het
Srrd A G 5: 112,342,899 V42A unknown Het
Stim1 A G 7: 102,431,050 H547R unknown Het
Svep1 G A 4: 58,070,517 A2423V probably benign Het
Tep1 A G 14: 50,829,230 S2304P possibly damaging Het
Tkt C G 14: 30,559,838 S104R probably benign Het
Tkt T C 14: 30,559,839 S105P probably damaging Het
Tln1 A T 4: 43,542,893 N1365K probably damaging Het
Topaz1 G T 9: 122,775,642 A1104S probably benign Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttll10 G T 4: 156,043,159 T389K probably benign Het
Tubal3 A G 13: 3,930,674 I129V probably benign Het
Ucp3 A G 7: 100,481,916 E192G probably damaging Het
Usp47 A G 7: 112,077,856 D448G probably damaging Het
Vmn2r98 T A 17: 19,081,234 L833M possibly damaging Het
Vps13d A G 4: 145,081,299 probably null Het
Wdr7 A G 18: 63,777,868 D777G possibly damaging Het
Zcchc8 A G 5: 123,709,237 I213T probably damaging Het
Zfp281 T C 1: 136,627,405 I707T probably damaging Het
Zfp335 T C 2: 164,893,475 H1158R probably damaging Het
Zfp692 C T 11: 58,308,939 T118M probably damaging Het
Zfr2 T A 10: 81,240,135 L192Q probably benign Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 114125942 missense possibly damaging 0.90
IGL00694:Aqr APN 2 114151525 missense probably damaging 1.00
IGL02113:Aqr APN 2 114120027 nonsense probably null
IGL02297:Aqr APN 2 114150481 missense probably benign 0.24
IGL02380:Aqr APN 2 114109936 missense probably damaging 1.00
IGL02410:Aqr APN 2 114136917 missense possibly damaging 0.85
IGL02413:Aqr APN 2 114118780 missense possibly damaging 0.87
IGL02474:Aqr APN 2 114112646 missense probably damaging 1.00
IGL02941:Aqr APN 2 114113354 missense probably damaging 1.00
IGL02981:Aqr APN 2 114134824 splice site probably benign
IGL03001:Aqr APN 2 114146919 missense probably benign
IGL03092:Aqr APN 2 114158943 missense probably benign 0.38
IGL03222:Aqr APN 2 114121256 missense probably damaging 1.00
capricorn UTSW 2 114105882 missense probably damaging 1.00
Goat UTSW 2 114157575 missense probably damaging 1.00
Pliades UTSW 2 114132976 missense probably damaging 1.00
sagittarius UTSW 2 114149016 missense probably damaging 1.00
Zodiac UTSW 2 114108109 missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 114130734 missense possibly damaging 0.94
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0152:Aqr UTSW 2 114159010 missense probably benign 0.07
R0352:Aqr UTSW 2 114170052 missense probably damaging 1.00
R0371:Aqr UTSW 2 114157604 missense possibly damaging 0.80
R0374:Aqr UTSW 2 114130611 missense probably damaging 1.00
R0550:Aqr UTSW 2 114132976 missense probably damaging 1.00
R0604:Aqr UTSW 2 114130604 missense probably benign 0.00
R0685:Aqr UTSW 2 114140977 missense probably damaging 1.00
R1236:Aqr UTSW 2 114116655 missense probably damaging 1.00
R1434:Aqr UTSW 2 114150409 missense probably damaging 1.00
R1806:Aqr UTSW 2 114161652 missense probably damaging 1.00
R2154:Aqr UTSW 2 114137004 missense probably damaging 1.00
R2185:Aqr UTSW 2 114130534 critical splice donor site probably null
R2377:Aqr UTSW 2 114140940 missense possibly damaging 0.58
R2862:Aqr UTSW 2 114136917 missense probably damaging 1.00
R3615:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3616:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3713:Aqr UTSW 2 114118669 splice site probably benign
R3715:Aqr UTSW 2 114118669 splice site probably benign
R4586:Aqr UTSW 2 114112577 missense probably benign 0.06
R4663:Aqr UTSW 2 114161666 nonsense probably null
R4809:Aqr UTSW 2 114175214 utr 5 prime probably benign
R4887:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4888:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4952:Aqr UTSW 2 114109937 missense probably damaging 1.00
R4974:Aqr UTSW 2 114113351 missense probably damaging 1.00
R5050:Aqr UTSW 2 114112609 nonsense probably null
R5050:Aqr UTSW 2 114170025 critical splice donor site probably null
R5213:Aqr UTSW 2 114113327 missense probably damaging 1.00
R5263:Aqr UTSW 2 114116578 missense probably damaging 1.00
R5470:Aqr UTSW 2 114157575 missense probably damaging 1.00
R5488:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5489:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5567:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5570:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5641:Aqr UTSW 2 114149034 missense probably damaging 1.00
R5685:Aqr UTSW 2 114156265 missense possibly damaging 0.87
R5963:Aqr UTSW 2 114126961 missense probably damaging 1.00
R5992:Aqr UTSW 2 114143049 nonsense probably null
R6015:Aqr UTSW 2 114175165 start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 114156277 missense possibly damaging 0.93
R6264:Aqr UTSW 2 114109964 missense probably damaging 1.00
R6773:Aqr UTSW 2 114148996 missense possibly damaging 0.64
R6877:Aqr UTSW 2 114116571 nonsense probably null
R7211:Aqr UTSW 2 114134723 missense probably benign 0.01
R7232:Aqr UTSW 2 114105882 missense probably damaging 1.00
R7308:Aqr UTSW 2 114104062 missense possibly damaging 0.86
R7396:Aqr UTSW 2 114119946 nonsense probably null
R7490:Aqr UTSW 2 114158868 critical splice donor site probably null
R7526:Aqr UTSW 2 114108109 missense probably damaging 0.96
R7629:Aqr UTSW 2 114114593 missense probably damaging 1.00
R7828:Aqr UTSW 2 114149016 missense probably damaging 1.00
R8037:Aqr UTSW 2 114161680 missense probably damaging 1.00
R8166:Aqr UTSW 2 114113325 missense possibly damaging 0.95
R8712:Aqr UTSW 2 114118877 missense probably damaging 1.00
R8904:Aqr UTSW 2 114136993 missense probably damaging 0.98
R9527:Aqr UTSW 2 114101556 missense probably benign 0.02
R9664:Aqr UTSW 2 114140915 nonsense probably null
Z1176:Aqr UTSW 2 114108122 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114109991 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGCTATGCTAACCAGACAGCC -3'
(R):5'- TCTAGCGGTTGTTACAGATTCAG -3'

Sequencing Primer
(F):5'- GGACAATGGCTATGATCATTATCTAG -3'
(R):5'- TTACAGATTCAGAAAGGGGCTTATGC -3'
Posted On 2022-07-18