Incidental Mutation 'R9487:Frem2'
ID 716647
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene Name Fras1 related extracellular matrix protein 2
Synonyms my, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 53513938-53657355 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53653484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1201 (I1201F)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000091137
AA Change: I1201F

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: I1201F

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik C T 1: 53,182,506 D55N possibly damaging Het
Abcc2 G A 19: 43,818,032 G762S probably damaging Het
Acta2 C A 19: 34,248,465 A110S probably damaging Het
Adam26a T C 8: 43,569,419 T345A possibly damaging Het
Anapc11 T C 11: 120,605,424 *85R probably null Het
Ang2 A C 14: 51,195,614 C104G probably damaging Het
Ankzf1 G A 1: 75,197,952 V529I probably benign Het
Aox4 G T 1: 58,248,938 V737F probably benign Het
Aqr T C 2: 114,104,047 N1371S probably benign Het
Bach1 T A 16: 87,729,845 S732T probably benign Het
Bcr T A 10: 75,131,599 I555N probably damaging Het
Bicra T C 7: 15,971,792 T1575A probably damaging Het
Bop1 A G 15: 76,453,876 L598P probably damaging Het
Cacna1d A T 14: 30,123,462 F605L possibly damaging Het
Capn15 C T 17: 25,965,379 V109I possibly damaging Het
Cdkn1b T C 6: 134,920,852 probably benign Het
Dnah2 T C 11: 69,515,791 T542A possibly damaging Het
Dsc2 A T 18: 20,047,219 I159N probably damaging Het
Ecel1 A T 1: 87,147,994 V774E probably damaging Het
Eif5b T A 1: 38,019,370 L251* probably null Het
Eif5b T G 1: 38,045,479 C849W probably damaging Het
Ext2 T C 2: 93,762,611 D416G probably damaging Het
Fancm G A 12: 65,106,614 W1281* probably null Het
Flvcr1 A T 1: 191,011,632 I409K possibly damaging Het
Foxk1 T C 5: 142,451,634 probably null Het
Gabra5 A G 7: 57,508,125 probably benign Het
Gm340 C A 19: 41,585,246 N813K probably damaging Het
Gmpr2 G A 14: 55,678,321 V319I probably damaging Het
Gna12 A T 5: 140,760,583 L369Q probably damaging Het
Gpr160 A G 3: 30,896,765 R329G probably benign Het
H2-M10.3 T C 17: 36,366,531 H285R probably benign Het
H2-M2 A T 17: 37,482,533 V194E probably benign Het
Hephl1 G A 9: 15,084,534 R431W possibly damaging Het
Hr A G 14: 70,556,437 T46A probably benign Het
Hr A G 14: 70,556,765 H126R possibly damaging Het
Hsf1 T G 15: 76,498,198 D256E probably benign Het
Ifi208 C T 1: 173,683,395 T372I probably damaging Het
Ifi47 T G 11: 49,095,793 F129C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Itga11 A T 9: 62,762,889 N765I probably benign Het
Klhl22 T A 16: 17,771,799 I108K probably benign Het
Lancl1 T G 1: 67,034,222 H34P probably benign Het
Lrmp A G 6: 145,174,531 I491V probably benign Het
Mbd3l1 G A 9: 18,484,978 G133D probably benign Het
Med12l T C 3: 59,247,932 F1178L probably benign Het
Mrm1 A T 11: 84,814,705 N289K probably damaging Het
Myf6 A G 10: 107,494,212 Y165H probably benign Het
Myo1g C A 11: 6,506,913 C971F probably benign Het
Myo3a T C 2: 22,241,051 M3T probably benign Het
Nsrp1 G A 11: 77,046,288 R361* probably null Het
Olfr1055 T A 2: 86,347,502 D88V probably benign Het
Olfr1241 T C 2: 89,482,412 H241R probably damaging Het
Olfr1250 T C 2: 89,657,387 D18G probably damaging Het
Olfr478 A T 7: 108,031,956 I129N possibly damaging Het
Olfr55 C A 17: 33,176,574 H57Q possibly damaging Het
Olfr890 G A 9: 38,143,570 C140Y probably benign Het
Olfr963 A C 9: 39,669,315 Q86P possibly damaging Het
Oscar T G 7: 3,611,664 Y103S probably damaging Het
Pdpr A G 8: 111,126,293 N610S probably benign Het
Ppp4r3b T C 11: 29,174,697 I56T probably damaging Het
Pxdn T A 12: 29,994,553 V510D possibly damaging Het
Rab11fip5 T C 6: 85,347,931 S465G possibly damaging Het
Rasgrf2 T C 13: 92,131,251 T82A probably benign Het
Scmh1 G A 4: 120,463,087 W30* probably null Het
Sema4g T C 19: 44,992,632 Y40H probably benign Het
Serpinf2 A T 11: 75,432,668 M404K probably damaging Het
Sgk3 T C 1: 9,880,391 probably null Het
Slc16a5 A T 11: 115,469,912 Y307F possibly damaging Het
Slc39a5 G A 10: 128,397,759 L290F probably damaging Het
Snx32 A C 19: 5,497,708 D191E probably damaging Het
Sp4 T C 12: 118,299,124 I396V probably benign Het
Srrd A G 5: 112,342,899 V42A unknown Het
Stim1 A G 7: 102,431,050 H547R unknown Het
Svep1 G A 4: 58,070,517 A2423V probably benign Het
Tep1 A G 14: 50,829,230 S2304P possibly damaging Het
Tkt C G 14: 30,559,838 S104R probably benign Het
Tkt T C 14: 30,559,839 S105P probably damaging Het
Tln1 A T 4: 43,542,893 N1365K probably damaging Het
Topaz1 G T 9: 122,775,642 A1104S probably benign Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttll10 G T 4: 156,043,159 T389K probably benign Het
Tubal3 A G 13: 3,930,674 I129V probably benign Het
Ucp3 A G 7: 100,481,916 E192G probably damaging Het
Usp47 A G 7: 112,077,856 D448G probably damaging Het
Vmn2r98 T A 17: 19,081,234 L833M possibly damaging Het
Vps13d A G 4: 145,081,299 probably null Het
Wdr7 A G 18: 63,777,868 D777G possibly damaging Het
Zcchc8 A G 5: 123,709,237 I213T probably damaging Het
Zfp281 T C 1: 136,627,405 I707T probably damaging Het
Zfp335 T C 2: 164,893,475 H1158R probably damaging Het
Zfp692 C T 11: 58,308,939 T118M probably damaging Het
Zfr2 T A 10: 81,240,135 L192Q probably benign Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53654753 missense probably damaging 1.00
R7341:Frem2 UTSW 3 53654495 missense probably damaging 1.00
R7455:Frem2 UTSW 3 53572280 splice site probably null
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
R7495:Frem2 UTSW 3 53516837 missense probably benign 0.13
R7542:Frem2 UTSW 3 53652579 missense probably damaging 1.00
R7636:Frem2 UTSW 3 53653247 missense probably benign 0.00
R7703:Frem2 UTSW 3 53522168 missense probably benign 0.01
R7750:Frem2 UTSW 3 53523682 missense possibly damaging 0.83
R7849:Frem2 UTSW 3 53572374 missense probably damaging 1.00
R7922:Frem2 UTSW 3 53653304 missense probably damaging 0.98
R8008:Frem2 UTSW 3 53652910 missense probably damaging 1.00
R8051:Frem2 UTSW 3 53535355 missense probably benign 0.04
R8052:Frem2 UTSW 3 53549643 missense probably benign 0.02
R8176:Frem2 UTSW 3 53655340 missense possibly damaging 0.50
R8220:Frem2 UTSW 3 53656507 nonsense probably null
R8397:Frem2 UTSW 3 53653141 missense probably benign 0.00
R8410:Frem2 UTSW 3 53539177 missense possibly damaging 0.60
R8697:Frem2 UTSW 3 53525828 missense probably damaging 0.99
R9134:Frem2 UTSW 3 53654900 missense probably damaging 1.00
R9183:Frem2 UTSW 3 53520065 missense probably damaging 1.00
R9260:Frem2 UTSW 3 53652783 missense probably damaging 1.00
R9267:Frem2 UTSW 3 53657083 start codon destroyed probably null 0.00
R9299:Frem2 UTSW 3 53656559 missense probably benign 0.37
R9378:Frem2 UTSW 3 53651989 missense probably damaging 0.99
R9444:Frem2 UTSW 3 53652844 missense probably benign 0.10
R9459:Frem2 UTSW 3 53653486 missense probably benign
Z1177:Frem2 UTSW 3 53535166 missense probably null 1.00
Z1177:Frem2 UTSW 3 53655607 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGTGTCTCAGAGTCATCGTGC -3'
(R):5'- GATCTCAGGCAAGGACACATTAAC -3'

Sequencing Primer
(F):5'- CGTGCTCATAAATAATGCTGGAACTC -3'
(R):5'- CTATGTCCAGAGTGTCCACAGAG -3'
Posted On 2022-07-18