Incidental Mutation 'R9487:Tln1'
ID 716649
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43531513-43562583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43542893 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1365 (N1365K)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000030187
AA Change: N1365K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: N1365K

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik C T 1: 53,221,665 (GRCm39) D55N possibly damaging Het
Abcc2 G A 19: 43,806,471 (GRCm39) G762S probably damaging Het
Acta2 C A 19: 34,225,865 (GRCm39) A110S probably damaging Het
Adam26a T C 8: 44,022,456 (GRCm39) T345A possibly damaging Het
Anapc11 T C 11: 120,496,250 (GRCm39) *85R probably null Het
Ang2 A C 14: 51,433,071 (GRCm39) C104G probably damaging Het
Ankzf1 G A 1: 75,174,596 (GRCm39) V529I probably benign Het
Aox4 G T 1: 58,288,097 (GRCm39) V737F probably benign Het
Aqr T C 2: 113,934,528 (GRCm39) N1371S probably benign Het
Bach1 T A 16: 87,526,733 (GRCm39) S732T probably benign Het
Bcr T A 10: 74,967,431 (GRCm39) I555N probably damaging Het
Bicra T C 7: 15,705,717 (GRCm39) T1575A probably damaging Het
Bop1 A G 15: 76,338,076 (GRCm39) L598P probably damaging Het
Cacna1d A T 14: 29,845,419 (GRCm39) F605L possibly damaging Het
Capn15 C T 17: 26,184,353 (GRCm39) V109I possibly damaging Het
Cdkn1b T C 6: 134,897,815 (GRCm39) probably benign Het
Dnah2 T C 11: 69,406,617 (GRCm39) T542A possibly damaging Het
Dsc2 A T 18: 20,180,276 (GRCm39) I159N probably damaging Het
Ecel1 A T 1: 87,075,716 (GRCm39) V774E probably damaging Het
Eif5b T G 1: 38,084,560 (GRCm39) C849W probably damaging Het
Eif5b T A 1: 38,058,451 (GRCm39) L251* probably null Het
Ext2 T C 2: 93,592,956 (GRCm39) D416G probably damaging Het
Fancm G A 12: 65,153,388 (GRCm39) W1281* probably null Het
Flvcr1 A T 1: 190,743,829 (GRCm39) I409K possibly damaging Het
Foxk1 T C 5: 142,437,389 (GRCm39) probably null Het
Frem2 T A 3: 53,560,905 (GRCm39) I1201F possibly damaging Het
Gabra5 A G 7: 57,157,873 (GRCm39) probably benign Het
Gmpr2 G A 14: 55,915,778 (GRCm39) V319I probably damaging Het
Gna12 A T 5: 140,746,338 (GRCm39) L369Q probably damaging Het
Gpr160 A G 3: 30,950,914 (GRCm39) R329G probably benign Het
H2-M10.3 T C 17: 36,677,423 (GRCm39) H285R probably benign Het
H2-M2 A T 17: 37,793,424 (GRCm39) V194E probably benign Het
Hephl1 G A 9: 14,995,830 (GRCm39) R431W possibly damaging Het
Hr A G 14: 70,793,877 (GRCm39) T46A probably benign Het
Hr A G 14: 70,794,205 (GRCm39) H126R possibly damaging Het
Hsf1 T G 15: 76,382,398 (GRCm39) D256E probably benign Het
Ifi208 C T 1: 173,510,961 (GRCm39) T372I probably damaging Het
Ifi47 T G 11: 48,986,620 (GRCm39) F129C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Irag2 A G 6: 145,120,257 (GRCm39) I491V probably benign Het
Itga11 A T 9: 62,670,171 (GRCm39) N765I probably benign Het
Klhl22 T A 16: 17,589,663 (GRCm39) I108K probably benign Het
Lancl1 T G 1: 67,073,381 (GRCm39) H34P probably benign Het
Lcor C A 19: 41,573,685 (GRCm39) N813K probably damaging Het
Mbd3l1 G A 9: 18,396,274 (GRCm39) G133D probably benign Het
Med12l T C 3: 59,155,353 (GRCm39) F1178L probably benign Het
Mrm1 A T 11: 84,705,531 (GRCm39) N289K probably damaging Het
Myf6 A G 10: 107,330,073 (GRCm39) Y165H probably benign Het
Myo1g C A 11: 6,456,913 (GRCm39) C971F probably benign Het
Myo3a T C 2: 22,245,862 (GRCm39) M3T probably benign Het
Nsrp1 G A 11: 76,937,114 (GRCm39) R361* probably null Het
Or10d4 A C 9: 39,580,611 (GRCm39) Q86P possibly damaging Het
Or10h1b C A 17: 33,395,548 (GRCm39) H57Q possibly damaging Het
Or4a69 T C 2: 89,312,756 (GRCm39) H241R probably damaging Het
Or4a77 T C 2: 89,487,731 (GRCm39) D18G probably damaging Het
Or5p6 A T 7: 107,631,163 (GRCm39) I129N possibly damaging Het
Or8b41 G A 9: 38,054,866 (GRCm39) C140Y probably benign Het
Or8k53 T A 2: 86,177,846 (GRCm39) D88V probably benign Het
Oscar T G 7: 3,614,663 (GRCm39) Y103S probably damaging Het
Pdpr A G 8: 111,852,925 (GRCm39) N610S probably benign Het
Ppp4r3b T C 11: 29,124,697 (GRCm39) I56T probably damaging Het
Pxdn T A 12: 30,044,552 (GRCm39) V510D possibly damaging Het
Rab11fip5 T C 6: 85,324,913 (GRCm39) S465G possibly damaging Het
Rasgrf2 T C 13: 92,267,759 (GRCm39) T82A probably benign Het
Scmh1 G A 4: 120,320,284 (GRCm39) W30* probably null Het
Sema4g T C 19: 44,981,071 (GRCm39) Y40H probably benign Het
Serpinf2 A T 11: 75,323,494 (GRCm39) M404K probably damaging Het
Sgk3 T C 1: 9,950,616 (GRCm39) probably null Het
Slc16a5 A T 11: 115,360,738 (GRCm39) Y307F possibly damaging Het
Slc39a5 G A 10: 128,233,628 (GRCm39) L290F probably damaging Het
Snx32 A C 19: 5,547,736 (GRCm39) D191E probably damaging Het
Sp4 T C 12: 118,262,859 (GRCm39) I396V probably benign Het
Srrd A G 5: 112,490,765 (GRCm39) V42A unknown Het
Stim1 A G 7: 102,080,257 (GRCm39) H547R unknown Het
Svep1 G A 4: 58,070,517 (GRCm39) A2423V probably benign Het
Tep1 A G 14: 51,066,687 (GRCm39) S2304P possibly damaging Het
Tkt C G 14: 30,281,795 (GRCm39) S104R probably benign Het
Tkt T C 14: 30,281,796 (GRCm39) S105P probably damaging Het
Topaz1 G T 9: 122,604,707 (GRCm39) A1104S probably benign Het
Trmt2a A G 16: 18,068,814 (GRCm39) H270R probably damaging Het
Ttll10 G T 4: 156,127,616 (GRCm39) T389K probably benign Het
Tubal3 A G 13: 3,980,674 (GRCm39) I129V probably benign Het
Ucp3 A G 7: 100,131,123 (GRCm39) E192G probably damaging Het
Usp47 A G 7: 111,677,063 (GRCm39) D448G probably damaging Het
Vmn2r98 T A 17: 19,301,496 (GRCm39) L833M possibly damaging Het
Vps13d A G 4: 144,807,869 (GRCm39) probably null Het
Wdr7 A G 18: 63,910,939 (GRCm39) D777G possibly damaging Het
Zcchc8 A G 5: 123,847,300 (GRCm39) I213T probably damaging Het
Zfp281 T C 1: 136,555,143 (GRCm39) I707T probably damaging Het
Zfp335 T C 2: 164,735,395 (GRCm39) H1158R probably damaging Het
Zfp692 C T 11: 58,199,765 (GRCm39) T118M probably damaging Het
Zfr2 T A 10: 81,075,969 (GRCm39) L192Q probably benign Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43,542,719 (GRCm39) missense probably benign 0.22
IGL00987:Tln1 APN 4 43,551,297 (GRCm39) unclassified probably benign
IGL01345:Tln1 APN 4 43,536,281 (GRCm39) missense probably damaging 1.00
IGL01456:Tln1 APN 4 43,543,432 (GRCm39) unclassified probably benign
IGL01715:Tln1 APN 4 43,555,890 (GRCm39) missense probably damaging 1.00
IGL01750:Tln1 APN 4 43,545,435 (GRCm39) missense probably damaging 1.00
IGL01933:Tln1 APN 4 43,555,894 (GRCm39) missense possibly damaging 0.52
IGL01933:Tln1 APN 4 43,539,508 (GRCm39) missense probably benign
IGL02119:Tln1 APN 4 43,546,760 (GRCm39) missense probably damaging 0.99
IGL02148:Tln1 APN 4 43,555,388 (GRCm39) missense probably damaging 1.00
IGL02153:Tln1 APN 4 43,546,857 (GRCm39) missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43,540,612 (GRCm39) missense probably benign 0.07
IGL02691:Tln1 APN 4 43,539,544 (GRCm39) missense probably benign 0.42
IGL02882:Tln1 APN 4 43,539,522 (GRCm39) missense probably benign 0.45
IGL02892:Tln1 APN 4 43,555,679 (GRCm39) missense probably damaging 1.00
IGL03061:Tln1 APN 4 43,545,694 (GRCm39) missense probably damaging 1.00
IGL03102:Tln1 APN 4 43,532,861 (GRCm39) missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43,539,084 (GRCm39) splice site probably benign
H8786:Tln1 UTSW 4 43,544,589 (GRCm39) missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43,539,998 (GRCm39) missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43,542,701 (GRCm39) critical splice donor site probably null
R0206:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0208:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0454:Tln1 UTSW 4 43,553,504 (GRCm39) missense probably benign
R0539:Tln1 UTSW 4 43,543,434 (GRCm39) critical splice donor site probably null
R0548:Tln1 UTSW 4 43,542,709 (GRCm39) missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43,550,304 (GRCm39) missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43,547,756 (GRCm39) missense probably benign 0.34
R0607:Tln1 UTSW 4 43,553,071 (GRCm39) missense probably damaging 1.00
R0609:Tln1 UTSW 4 43,544,645 (GRCm39) missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43,555,333 (GRCm39) missense probably damaging 1.00
R0993:Tln1 UTSW 4 43,549,825 (GRCm39) missense probably benign 0.22
R1255:Tln1 UTSW 4 43,538,044 (GRCm39) missense probably damaging 1.00
R1292:Tln1 UTSW 4 43,534,578 (GRCm39) critical splice donor site probably null
R1752:Tln1 UTSW 4 43,536,311 (GRCm39) missense probably damaging 1.00
R2169:Tln1 UTSW 4 43,548,005 (GRCm39) missense probably damaging 1.00
R2172:Tln1 UTSW 4 43,545,721 (GRCm39) missense probably benign
R2202:Tln1 UTSW 4 43,553,083 (GRCm39) splice site probably null
R2680:Tln1 UTSW 4 43,539,668 (GRCm39) missense probably damaging 1.00
R3012:Tln1 UTSW 4 43,542,525 (GRCm39) missense probably benign
R3714:Tln1 UTSW 4 43,540,597 (GRCm39) missense probably damaging 1.00
R3735:Tln1 UTSW 4 43,549,370 (GRCm39) missense probably damaging 0.97
R3794:Tln1 UTSW 4 43,536,295 (GRCm39) missense probably damaging 1.00
R3825:Tln1 UTSW 4 43,536,413 (GRCm39) splice site probably benign
R3983:Tln1 UTSW 4 43,553,030 (GRCm39) missense probably damaging 1.00
R4061:Tln1 UTSW 4 43,549,177 (GRCm39) missense probably damaging 1.00
R4249:Tln1 UTSW 4 43,536,104 (GRCm39) missense probably damaging 1.00
R4287:Tln1 UTSW 4 43,543,509 (GRCm39) missense probably benign 0.01
R4471:Tln1 UTSW 4 43,551,018 (GRCm39) missense probably benign 0.03
R4562:Tln1 UTSW 4 43,533,598 (GRCm39) missense probably damaging 1.00
R4654:Tln1 UTSW 4 43,535,954 (GRCm39) missense probably null 1.00
R4737:Tln1 UTSW 4 43,540,588 (GRCm39) missense probably benign 0.00
R4936:Tln1 UTSW 4 43,547,522 (GRCm39) missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43,539,406 (GRCm39) missense probably benign 0.06
R5288:Tln1 UTSW 4 43,540,661 (GRCm39) missense probably benign 0.06
R5421:Tln1 UTSW 4 43,533,609 (GRCm39) missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43,543,905 (GRCm39) missense probably benign 0.26
R5660:Tln1 UTSW 4 43,547,732 (GRCm39) missense probably damaging 1.00
R5772:Tln1 UTSW 4 43,545,191 (GRCm39) missense probably benign 0.13
R6012:Tln1 UTSW 4 43,539,508 (GRCm39) missense probably benign
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6052:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6145:Tln1 UTSW 4 43,538,030 (GRCm39) missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43,534,744 (GRCm39) missense probably benign 0.06
R6242:Tln1 UTSW 4 43,533,145 (GRCm39) missense probably damaging 1.00
R6454:Tln1 UTSW 4 43,533,866 (GRCm39) missense probably damaging 0.99
R6467:Tln1 UTSW 4 43,543,165 (GRCm39) missense probably benign 0.42
R6548:Tln1 UTSW 4 43,547,525 (GRCm39) missense probably damaging 0.98
R6576:Tln1 UTSW 4 43,555,419 (GRCm39) splice site probably null
R6722:Tln1 UTSW 4 43,547,618 (GRCm39) missense probably damaging 1.00
R6968:Tln1 UTSW 4 43,550,217 (GRCm39) missense probably benign 0.02
R7000:Tln1 UTSW 4 43,556,302 (GRCm39) missense probably damaging 0.96
R7137:Tln1 UTSW 4 43,540,616 (GRCm39) missense probably damaging 1.00
R7242:Tln1 UTSW 4 43,542,602 (GRCm39) missense probably benign 0.01
R7294:Tln1 UTSW 4 43,534,399 (GRCm39) missense probably benign 0.02
R7312:Tln1 UTSW 4 43,545,922 (GRCm39) missense probably damaging 1.00
R7547:Tln1 UTSW 4 43,545,206 (GRCm39) missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43,554,309 (GRCm39) missense probably benign 0.01
R7874:Tln1 UTSW 4 43,555,606 (GRCm39) missense probably damaging 1.00
R7874:Tln1 UTSW 4 43,538,041 (GRCm39) missense probably damaging 1.00
R8030:Tln1 UTSW 4 43,535,737 (GRCm39) critical splice donor site probably null
R8105:Tln1 UTSW 4 43,538,231 (GRCm39) missense probably benign 0.32
R8212:Tln1 UTSW 4 43,555,918 (GRCm39) missense probably damaging 1.00
R8416:Tln1 UTSW 4 43,540,116 (GRCm39) missense probably benign 0.01
R8419:Tln1 UTSW 4 43,536,397 (GRCm39) missense probably damaging 1.00
R8680:Tln1 UTSW 4 43,553,041 (GRCm39) missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43,534,769 (GRCm39) splice site probably benign
R8725:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43,556,383 (GRCm39) missense probably benign
R8865:Tln1 UTSW 4 43,538,281 (GRCm39) missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9050:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9145:Tln1 UTSW 4 43,536,024 (GRCm39) missense probably damaging 1.00
R9210:Tln1 UTSW 4 43,536,119 (GRCm39) missense probably damaging 1.00
R9337:Tln1 UTSW 4 43,532,927 (GRCm39) missense probably damaging 1.00
R9346:Tln1 UTSW 4 43,546,895 (GRCm39) missense probably damaging 0.97
R9358:Tln1 UTSW 4 43,532,084 (GRCm39) missense possibly damaging 0.68
R9631:Tln1 UTSW 4 43,545,694 (GRCm39) missense probably damaging 1.00
R9650:Tln1 UTSW 4 43,545,912 (GRCm39) missense probably damaging 1.00
R9666:Tln1 UTSW 4 43,542,957 (GRCm39) missense probably damaging 0.96
RF021:Tln1 UTSW 4 43,555,890 (GRCm39) missense probably damaging 1.00
X0052:Tln1 UTSW 4 43,533,125 (GRCm39) critical splice donor site probably null
X0063:Tln1 UTSW 4 43,548,015 (GRCm39) nonsense probably null
Z1176:Tln1 UTSW 4 43,543,211 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCGTCCCACTAACCTTGGAG -3'
(R):5'- TTCATGAGACACTCTGGGCATAG -3'

Sequencing Primer
(F):5'- GAGTTCTCCATGACACTGTCCAAG -3'
(R):5'- CACTCTGGGCATAGCAGTAG -3'
Posted On 2022-07-18