Incidental Mutation 'R9487:Cdkn1b'
ID 716659
Institutional Source Beutler Lab
Gene Symbol Cdkn1b
Ensembl Gene ENSMUSG00000003031
Gene Name cyclin dependent kinase inhibitor 1B
Synonyms p27Kip1, p27
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R9487 (G1)
Quality Score 150.008
Status Not validated
Chromosome 6
Chromosomal Location 134897364-134902476 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to C at 134897815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003115] [ENSMUST00000067327] [ENSMUST00000204807]
AlphaFold P46414
Predicted Effect probably benign
Transcript: ENSMUST00000003115
SMART Domains Protein: ENSMUSP00000003115
Gene: ENSMUSG00000003031

DomainStartEndE-ValueType
Pfam:CDI 30 80 8.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067327
SMART Domains Protein: ENSMUSP00000065832
Gene: ENSMUSG00000003031

DomainStartEndE-ValueType
Pfam:CDI 31 79 7.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204807
SMART Domains Protein: ENSMUSP00000145056
Gene: ENSMUSG00000003031

DomainStartEndE-ValueType
Pfam:CDI 31 79 7.6e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cyclin-dependent kinase inhibitor, which shares a limited similarity with CDK inhibitor CDKN1A/p21. The encoded protein binds to and prevents the activation of cyclin E-CDK2 or cyclin D-CDK4 complexes, and thus controls the cell cycle progression at G1. The degradation of this protein, which is triggered by its CDK dependent phosphorylation and subsequent ubiquitination by SCF complexes, is required for the cellular transition from quiescence to the proliferative state. Mutations in this gene are associated with multiple endocrine neoplasia type IV (MEN4). [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous mutants have increased body weight, enlargement of major organs, impaired hearing and increased tumor susceptibility. Females are sterile, having impaired luteal cell differentiation and disrupted estrus cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik C T 1: 53,221,665 (GRCm39) D55N possibly damaging Het
Abcc2 G A 19: 43,806,471 (GRCm39) G762S probably damaging Het
Acta2 C A 19: 34,225,865 (GRCm39) A110S probably damaging Het
Adam26a T C 8: 44,022,456 (GRCm39) T345A possibly damaging Het
Anapc11 T C 11: 120,496,250 (GRCm39) *85R probably null Het
Ang2 A C 14: 51,433,071 (GRCm39) C104G probably damaging Het
Ankzf1 G A 1: 75,174,596 (GRCm39) V529I probably benign Het
Aox4 G T 1: 58,288,097 (GRCm39) V737F probably benign Het
Aqr T C 2: 113,934,528 (GRCm39) N1371S probably benign Het
Bach1 T A 16: 87,526,733 (GRCm39) S732T probably benign Het
Bcr T A 10: 74,967,431 (GRCm39) I555N probably damaging Het
Bicra T C 7: 15,705,717 (GRCm39) T1575A probably damaging Het
Bop1 A G 15: 76,338,076 (GRCm39) L598P probably damaging Het
Cacna1d A T 14: 29,845,419 (GRCm39) F605L possibly damaging Het
Capn15 C T 17: 26,184,353 (GRCm39) V109I possibly damaging Het
Dnah2 T C 11: 69,406,617 (GRCm39) T542A possibly damaging Het
Dsc2 A T 18: 20,180,276 (GRCm39) I159N probably damaging Het
Ecel1 A T 1: 87,075,716 (GRCm39) V774E probably damaging Het
Eif5b T G 1: 38,084,560 (GRCm39) C849W probably damaging Het
Eif5b T A 1: 38,058,451 (GRCm39) L251* probably null Het
Ext2 T C 2: 93,592,956 (GRCm39) D416G probably damaging Het
Fancm G A 12: 65,153,388 (GRCm39) W1281* probably null Het
Flvcr1 A T 1: 190,743,829 (GRCm39) I409K possibly damaging Het
Foxk1 T C 5: 142,437,389 (GRCm39) probably null Het
Frem2 T A 3: 53,560,905 (GRCm39) I1201F possibly damaging Het
Gabra5 A G 7: 57,157,873 (GRCm39) probably benign Het
Gmpr2 G A 14: 55,915,778 (GRCm39) V319I probably damaging Het
Gna12 A T 5: 140,746,338 (GRCm39) L369Q probably damaging Het
Gpr160 A G 3: 30,950,914 (GRCm39) R329G probably benign Het
H2-M10.3 T C 17: 36,677,423 (GRCm39) H285R probably benign Het
H2-M2 A T 17: 37,793,424 (GRCm39) V194E probably benign Het
Hephl1 G A 9: 14,995,830 (GRCm39) R431W possibly damaging Het
Hr A G 14: 70,793,877 (GRCm39) T46A probably benign Het
Hr A G 14: 70,794,205 (GRCm39) H126R possibly damaging Het
Hsf1 T G 15: 76,382,398 (GRCm39) D256E probably benign Het
Ifi208 C T 1: 173,510,961 (GRCm39) T372I probably damaging Het
Ifi47 T G 11: 48,986,620 (GRCm39) F129C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Irag2 A G 6: 145,120,257 (GRCm39) I491V probably benign Het
Itga11 A T 9: 62,670,171 (GRCm39) N765I probably benign Het
Klhl22 T A 16: 17,589,663 (GRCm39) I108K probably benign Het
Lancl1 T G 1: 67,073,381 (GRCm39) H34P probably benign Het
Lcor C A 19: 41,573,685 (GRCm39) N813K probably damaging Het
Mbd3l1 G A 9: 18,396,274 (GRCm39) G133D probably benign Het
Med12l T C 3: 59,155,353 (GRCm39) F1178L probably benign Het
Mrm1 A T 11: 84,705,531 (GRCm39) N289K probably damaging Het
Myf6 A G 10: 107,330,073 (GRCm39) Y165H probably benign Het
Myo1g C A 11: 6,456,913 (GRCm39) C971F probably benign Het
Myo3a T C 2: 22,245,862 (GRCm39) M3T probably benign Het
Nsrp1 G A 11: 76,937,114 (GRCm39) R361* probably null Het
Or10d4 A C 9: 39,580,611 (GRCm39) Q86P possibly damaging Het
Or10h1b C A 17: 33,395,548 (GRCm39) H57Q possibly damaging Het
Or4a69 T C 2: 89,312,756 (GRCm39) H241R probably damaging Het
Or4a77 T C 2: 89,487,731 (GRCm39) D18G probably damaging Het
Or5p6 A T 7: 107,631,163 (GRCm39) I129N possibly damaging Het
Or8b41 G A 9: 38,054,866 (GRCm39) C140Y probably benign Het
Or8k53 T A 2: 86,177,846 (GRCm39) D88V probably benign Het
Oscar T G 7: 3,614,663 (GRCm39) Y103S probably damaging Het
Pdpr A G 8: 111,852,925 (GRCm39) N610S probably benign Het
Ppp4r3b T C 11: 29,124,697 (GRCm39) I56T probably damaging Het
Pxdn T A 12: 30,044,552 (GRCm39) V510D possibly damaging Het
Rab11fip5 T C 6: 85,324,913 (GRCm39) S465G possibly damaging Het
Rasgrf2 T C 13: 92,267,759 (GRCm39) T82A probably benign Het
Scmh1 G A 4: 120,320,284 (GRCm39) W30* probably null Het
Sema4g T C 19: 44,981,071 (GRCm39) Y40H probably benign Het
Serpinf2 A T 11: 75,323,494 (GRCm39) M404K probably damaging Het
Sgk3 T C 1: 9,950,616 (GRCm39) probably null Het
Slc16a5 A T 11: 115,360,738 (GRCm39) Y307F possibly damaging Het
Slc39a5 G A 10: 128,233,628 (GRCm39) L290F probably damaging Het
Snx32 A C 19: 5,547,736 (GRCm39) D191E probably damaging Het
Sp4 T C 12: 118,262,859 (GRCm39) I396V probably benign Het
Srrd A G 5: 112,490,765 (GRCm39) V42A unknown Het
Stim1 A G 7: 102,080,257 (GRCm39) H547R unknown Het
Svep1 G A 4: 58,070,517 (GRCm39) A2423V probably benign Het
Tep1 A G 14: 51,066,687 (GRCm39) S2304P possibly damaging Het
Tkt C G 14: 30,281,795 (GRCm39) S104R probably benign Het
Tkt T C 14: 30,281,796 (GRCm39) S105P probably damaging Het
Tln1 A T 4: 43,542,893 (GRCm39) N1365K probably damaging Het
Topaz1 G T 9: 122,604,707 (GRCm39) A1104S probably benign Het
Trmt2a A G 16: 18,068,814 (GRCm39) H270R probably damaging Het
Ttll10 G T 4: 156,127,616 (GRCm39) T389K probably benign Het
Tubal3 A G 13: 3,980,674 (GRCm39) I129V probably benign Het
Ucp3 A G 7: 100,131,123 (GRCm39) E192G probably damaging Het
Usp47 A G 7: 111,677,063 (GRCm39) D448G probably damaging Het
Vmn2r98 T A 17: 19,301,496 (GRCm39) L833M possibly damaging Het
Vps13d A G 4: 144,807,869 (GRCm39) probably null Het
Wdr7 A G 18: 63,910,939 (GRCm39) D777G possibly damaging Het
Zcchc8 A G 5: 123,847,300 (GRCm39) I213T probably damaging Het
Zfp281 T C 1: 136,555,143 (GRCm39) I707T probably damaging Het
Zfp335 T C 2: 164,735,395 (GRCm39) H1158R probably damaging Het
Zfp692 C T 11: 58,199,765 (GRCm39) T118M probably damaging Het
Zfr2 T A 10: 81,075,969 (GRCm39) L192Q probably benign Het
Other mutations in Cdkn1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Cdkn1b APN 6 134,897,970 (GRCm39) nonsense probably null
R1434:Cdkn1b UTSW 6 134,898,060 (GRCm39) missense probably damaging 1.00
R2005:Cdkn1b UTSW 6 134,898,919 (GRCm39) small insertion probably benign
R6213:Cdkn1b UTSW 6 134,898,206 (GRCm39) missense probably benign 0.03
R6518:Cdkn1b UTSW 6 134,898,283 (GRCm39) missense probably benign
R7409:Cdkn1b UTSW 6 134,898,280 (GRCm39) missense probably benign 0.45
R9711:Cdkn1b UTSW 6 134,898,058 (GRCm39) missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- AGTACACTTGATCACTGAAGCCTC -3'
(R):5'- AAGTCCCGGGTTAGTTCTTCATG -3'

Sequencing Primer
(F):5'- GGCTCTGCTCCATTTGAC -3'
(R):5'- CACTCTCACGTTTGACATC -3'
Posted On 2022-07-18