Incidental Mutation 'R9487:Dnah2'
ID 716684
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Name dynein, axonemal, heavy chain 2
Synonyms 2900022L05Rik, D330014H01Rik, Dnahc2, Dnhd3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69311635-69439934 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69406617 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 542 (T542A)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659] [ENSMUST00000208777]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035539
AA Change: T542A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: T542A

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108659
AA Change: T542A

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: T542A

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208777
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik C T 1: 53,221,665 (GRCm39) D55N possibly damaging Het
Abcc2 G A 19: 43,806,471 (GRCm39) G762S probably damaging Het
Acta2 C A 19: 34,225,865 (GRCm39) A110S probably damaging Het
Adam26a T C 8: 44,022,456 (GRCm39) T345A possibly damaging Het
Anapc11 T C 11: 120,496,250 (GRCm39) *85R probably null Het
Ang2 A C 14: 51,433,071 (GRCm39) C104G probably damaging Het
Ankzf1 G A 1: 75,174,596 (GRCm39) V529I probably benign Het
Aox4 G T 1: 58,288,097 (GRCm39) V737F probably benign Het
Aqr T C 2: 113,934,528 (GRCm39) N1371S probably benign Het
Bach1 T A 16: 87,526,733 (GRCm39) S732T probably benign Het
Bcr T A 10: 74,967,431 (GRCm39) I555N probably damaging Het
Bicra T C 7: 15,705,717 (GRCm39) T1575A probably damaging Het
Bop1 A G 15: 76,338,076 (GRCm39) L598P probably damaging Het
Cacna1d A T 14: 29,845,419 (GRCm39) F605L possibly damaging Het
Capn15 C T 17: 26,184,353 (GRCm39) V109I possibly damaging Het
Cdkn1b T C 6: 134,897,815 (GRCm39) probably benign Het
Dsc2 A T 18: 20,180,276 (GRCm39) I159N probably damaging Het
Ecel1 A T 1: 87,075,716 (GRCm39) V774E probably damaging Het
Eif5b T G 1: 38,084,560 (GRCm39) C849W probably damaging Het
Eif5b T A 1: 38,058,451 (GRCm39) L251* probably null Het
Ext2 T C 2: 93,592,956 (GRCm39) D416G probably damaging Het
Fancm G A 12: 65,153,388 (GRCm39) W1281* probably null Het
Flvcr1 A T 1: 190,743,829 (GRCm39) I409K possibly damaging Het
Foxk1 T C 5: 142,437,389 (GRCm39) probably null Het
Frem2 T A 3: 53,560,905 (GRCm39) I1201F possibly damaging Het
Gabra5 A G 7: 57,157,873 (GRCm39) probably benign Het
Gmpr2 G A 14: 55,915,778 (GRCm39) V319I probably damaging Het
Gna12 A T 5: 140,746,338 (GRCm39) L369Q probably damaging Het
Gpr160 A G 3: 30,950,914 (GRCm39) R329G probably benign Het
H2-M10.3 T C 17: 36,677,423 (GRCm39) H285R probably benign Het
H2-M2 A T 17: 37,793,424 (GRCm39) V194E probably benign Het
Hephl1 G A 9: 14,995,830 (GRCm39) R431W possibly damaging Het
Hr A G 14: 70,793,877 (GRCm39) T46A probably benign Het
Hr A G 14: 70,794,205 (GRCm39) H126R possibly damaging Het
Hsf1 T G 15: 76,382,398 (GRCm39) D256E probably benign Het
Ifi208 C T 1: 173,510,961 (GRCm39) T372I probably damaging Het
Ifi47 T G 11: 48,986,620 (GRCm39) F129C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Irag2 A G 6: 145,120,257 (GRCm39) I491V probably benign Het
Itga11 A T 9: 62,670,171 (GRCm39) N765I probably benign Het
Klhl22 T A 16: 17,589,663 (GRCm39) I108K probably benign Het
Lancl1 T G 1: 67,073,381 (GRCm39) H34P probably benign Het
Lcor C A 19: 41,573,685 (GRCm39) N813K probably damaging Het
Mbd3l1 G A 9: 18,396,274 (GRCm39) G133D probably benign Het
Med12l T C 3: 59,155,353 (GRCm39) F1178L probably benign Het
Mrm1 A T 11: 84,705,531 (GRCm39) N289K probably damaging Het
Myf6 A G 10: 107,330,073 (GRCm39) Y165H probably benign Het
Myo1g C A 11: 6,456,913 (GRCm39) C971F probably benign Het
Myo3a T C 2: 22,245,862 (GRCm39) M3T probably benign Het
Nsrp1 G A 11: 76,937,114 (GRCm39) R361* probably null Het
Or10d4 A C 9: 39,580,611 (GRCm39) Q86P possibly damaging Het
Or10h1b C A 17: 33,395,548 (GRCm39) H57Q possibly damaging Het
Or4a69 T C 2: 89,312,756 (GRCm39) H241R probably damaging Het
Or4a77 T C 2: 89,487,731 (GRCm39) D18G probably damaging Het
Or5p6 A T 7: 107,631,163 (GRCm39) I129N possibly damaging Het
Or8b41 G A 9: 38,054,866 (GRCm39) C140Y probably benign Het
Or8k53 T A 2: 86,177,846 (GRCm39) D88V probably benign Het
Oscar T G 7: 3,614,663 (GRCm39) Y103S probably damaging Het
Pdpr A G 8: 111,852,925 (GRCm39) N610S probably benign Het
Ppp4r3b T C 11: 29,124,697 (GRCm39) I56T probably damaging Het
Pxdn T A 12: 30,044,552 (GRCm39) V510D possibly damaging Het
Rab11fip5 T C 6: 85,324,913 (GRCm39) S465G possibly damaging Het
Rasgrf2 T C 13: 92,267,759 (GRCm39) T82A probably benign Het
Scmh1 G A 4: 120,320,284 (GRCm39) W30* probably null Het
Sema4g T C 19: 44,981,071 (GRCm39) Y40H probably benign Het
Serpinf2 A T 11: 75,323,494 (GRCm39) M404K probably damaging Het
Sgk3 T C 1: 9,950,616 (GRCm39) probably null Het
Slc16a5 A T 11: 115,360,738 (GRCm39) Y307F possibly damaging Het
Slc39a5 G A 10: 128,233,628 (GRCm39) L290F probably damaging Het
Snx32 A C 19: 5,547,736 (GRCm39) D191E probably damaging Het
Sp4 T C 12: 118,262,859 (GRCm39) I396V probably benign Het
Srrd A G 5: 112,490,765 (GRCm39) V42A unknown Het
Stim1 A G 7: 102,080,257 (GRCm39) H547R unknown Het
Svep1 G A 4: 58,070,517 (GRCm39) A2423V probably benign Het
Tep1 A G 14: 51,066,687 (GRCm39) S2304P possibly damaging Het
Tkt C G 14: 30,281,795 (GRCm39) S104R probably benign Het
Tkt T C 14: 30,281,796 (GRCm39) S105P probably damaging Het
Tln1 A T 4: 43,542,893 (GRCm39) N1365K probably damaging Het
Topaz1 G T 9: 122,604,707 (GRCm39) A1104S probably benign Het
Trmt2a A G 16: 18,068,814 (GRCm39) H270R probably damaging Het
Ttll10 G T 4: 156,127,616 (GRCm39) T389K probably benign Het
Tubal3 A G 13: 3,980,674 (GRCm39) I129V probably benign Het
Ucp3 A G 7: 100,131,123 (GRCm39) E192G probably damaging Het
Usp47 A G 7: 111,677,063 (GRCm39) D448G probably damaging Het
Vmn2r98 T A 17: 19,301,496 (GRCm39) L833M possibly damaging Het
Vps13d A G 4: 144,807,869 (GRCm39) probably null Het
Wdr7 A G 18: 63,910,939 (GRCm39) D777G possibly damaging Het
Zcchc8 A G 5: 123,847,300 (GRCm39) I213T probably damaging Het
Zfp281 T C 1: 136,555,143 (GRCm39) I707T probably damaging Het
Zfp335 T C 2: 164,735,395 (GRCm39) H1158R probably damaging Het
Zfp692 C T 11: 58,199,765 (GRCm39) T118M probably damaging Het
Zfr2 T A 10: 81,075,969 (GRCm39) L192Q probably benign Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69,383,498 (GRCm39) missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69,385,892 (GRCm39) splice site probably benign
IGL00772:Dnah2 APN 11 69,342,083 (GRCm39) missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69,364,176 (GRCm39) critical splice donor site probably null
IGL00827:Dnah2 APN 11 69,339,283 (GRCm39) missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69,368,918 (GRCm39) missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69,384,010 (GRCm39) missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69,366,432 (GRCm39) missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69,323,790 (GRCm39) missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69,365,017 (GRCm39) splice site probably benign
IGL01480:Dnah2 APN 11 69,349,197 (GRCm39) missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69,406,906 (GRCm39) missense probably benign 0.17
IGL01592:Dnah2 APN 11 69,321,913 (GRCm39) missense probably benign 0.14
IGL01612:Dnah2 APN 11 69,355,889 (GRCm39) splice site probably benign
IGL01667:Dnah2 APN 11 69,435,221 (GRCm39) missense probably benign
IGL01667:Dnah2 APN 11 69,411,767 (GRCm39) missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69,430,269 (GRCm39) missense probably benign
IGL02019:Dnah2 APN 11 69,365,111 (GRCm39) missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69,390,038 (GRCm39) missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69,313,385 (GRCm39) missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69,349,011 (GRCm39) missense probably benign 0.07
IGL02158:Dnah2 APN 11 69,348,949 (GRCm39) missense probably benign
IGL02381:Dnah2 APN 11 69,337,118 (GRCm39) missense probably benign 0.25
IGL02681:Dnah2 APN 11 69,343,759 (GRCm39) missense probably benign 0.40
IGL02957:Dnah2 APN 11 69,339,333 (GRCm39) missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69,409,240 (GRCm39) missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69,412,013 (GRCm39) missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69,327,117 (GRCm39) splice site probably benign
IGL03120:Dnah2 APN 11 69,312,674 (GRCm39) missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69,349,314 (GRCm39) missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69,350,089 (GRCm39) missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69,420,207 (GRCm39) critical splice donor site probably null
IGL03333:Dnah2 APN 11 69,385,949 (GRCm39) missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69,387,403 (GRCm39) missense probably benign 0.13
argyrios UTSW 11 69,407,416 (GRCm39) missense possibly damaging 0.47
Aureus UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
platinum UTSW 11 69,348,868 (GRCm39) missense probably damaging 0.96
R0334_dnah2_144 UTSW 11 69,327,662 (GRCm39) missense probably damaging 1.00
R2150_dnah2_212 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
BB005:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
BB015:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
E0370:Dnah2 UTSW 11 69,406,441 (GRCm39) splice site probably null
P0026:Dnah2 UTSW 11 69,355,773 (GRCm39) missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69,311,835 (GRCm39) missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69,326,075 (GRCm39) missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69,327,662 (GRCm39) missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69,420,357 (GRCm39) missense probably benign 0.00
R0386:Dnah2 UTSW 11 69,338,687 (GRCm39) missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69,390,064 (GRCm39) missense probably benign 0.26
R0427:Dnah2 UTSW 11 69,343,705 (GRCm39) missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69,350,114 (GRCm39) missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69,339,368 (GRCm39) missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69,350,027 (GRCm39) missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69,313,952 (GRCm39) missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69,390,020 (GRCm39) missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69,368,509 (GRCm39) missense probably benign 0.07
R0924:Dnah2 UTSW 11 69,312,134 (GRCm39) missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69,339,345 (GRCm39) missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69,338,645 (GRCm39) missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69,337,474 (GRCm39) missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69,390,016 (GRCm39) missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69,406,526 (GRCm39) missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69,341,876 (GRCm39) missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69,411,493 (GRCm39) splice site probably null
R1538:Dnah2 UTSW 11 69,368,028 (GRCm39) missense probably benign 0.17
R1574:Dnah2 UTSW 11 69,405,514 (GRCm39) missense probably benign 0.26
R1574:Dnah2 UTSW 11 69,405,514 (GRCm39) missense probably benign 0.26
R1590:Dnah2 UTSW 11 69,412,024 (GRCm39) missense probably benign 0.00
R1590:Dnah2 UTSW 11 69,313,580 (GRCm39) critical splice donor site probably null
R1655:Dnah2 UTSW 11 69,364,680 (GRCm39) missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69,405,517 (GRCm39) missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69,388,715 (GRCm39) missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69,314,369 (GRCm39) missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69,366,400 (GRCm39) missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69,405,630 (GRCm39) missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69,328,712 (GRCm39) missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69,406,578 (GRCm39) missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69,355,756 (GRCm39) missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69,365,151 (GRCm39) missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69,349,184 (GRCm39) critical splice donor site probably null
R2016:Dnah2 UTSW 11 69,327,896 (GRCm39) missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69,327,896 (GRCm39) missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69,415,066 (GRCm39) missense probably benign 0.14
R2077:Dnah2 UTSW 11 69,387,432 (GRCm39) missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69,346,742 (GRCm39) missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69,384,063 (GRCm39) missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69,349,011 (GRCm39) missense probably benign 0.02
R2128:Dnah2 UTSW 11 69,349,011 (GRCm39) missense probably benign 0.02
R2146:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2147:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2150:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2404:Dnah2 UTSW 11 69,328,047 (GRCm39) missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69,415,032 (GRCm39) nonsense probably null
R2517:Dnah2 UTSW 11 69,407,470 (GRCm39) missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69,321,304 (GRCm39) missense probably benign
R3741:Dnah2 UTSW 11 69,339,295 (GRCm39) missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69,383,476 (GRCm39) splice site probably null
R3872:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69,342,173 (GRCm39) missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69,344,929 (GRCm39) missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69,374,847 (GRCm39) missense probably benign 0.00
R4501:Dnah2 UTSW 11 69,368,485 (GRCm39) missense probably benign
R4515:Dnah2 UTSW 11 69,356,457 (GRCm39) missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69,374,193 (GRCm39) missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69,354,487 (GRCm39) missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69,356,202 (GRCm39) missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69,387,385 (GRCm39) missense probably benign 0.00
R4683:Dnah2 UTSW 11 69,349,768 (GRCm39) missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69,389,358 (GRCm39) missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69,368,903 (GRCm39) missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69,407,416 (GRCm39) missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69,367,514 (GRCm39) missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69,320,183 (GRCm39) missense probably benign 0.00
R4740:Dnah2 UTSW 11 69,348,868 (GRCm39) missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69,364,697 (GRCm39) missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69,314,031 (GRCm39) missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69,313,416 (GRCm39) missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69,354,474 (GRCm39) missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69,367,517 (GRCm39) missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69,411,973 (GRCm39) missense probably benign 0.00
R4911:Dnah2 UTSW 11 69,389,930 (GRCm39) critical splice donor site probably null
R4954:Dnah2 UTSW 11 69,430,322 (GRCm39) missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69,346,799 (GRCm39) nonsense probably null
R5015:Dnah2 UTSW 11 69,388,708 (GRCm39) missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69,338,992 (GRCm39) missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69,411,599 (GRCm39) missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69,411,759 (GRCm39) missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69,313,362 (GRCm39) missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69,326,710 (GRCm39) missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5208:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5252:Dnah2 UTSW 11 69,420,295 (GRCm39) missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5298:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5299:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5301:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5324:Dnah2 UTSW 11 69,348,819 (GRCm39) missense probably benign 0.07
R5350:Dnah2 UTSW 11 69,406,862 (GRCm39) missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69,312,674 (GRCm39) missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69,391,683 (GRCm39) missense probably benign
R5421:Dnah2 UTSW 11 69,326,462 (GRCm39) missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69,415,209 (GRCm39) missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69,364,177 (GRCm39) critical splice donor site probably null
R5474:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5476:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5477:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5510:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5527:Dnah2 UTSW 11 69,328,014 (GRCm39) nonsense probably null
R5566:Dnah2 UTSW 11 69,407,395 (GRCm39) nonsense probably null
R5587:Dnah2 UTSW 11 69,328,068 (GRCm39) missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5688:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5690:Dnah2 UTSW 11 69,382,370 (GRCm39) missense probably benign 0.15
R5711:Dnah2 UTSW 11 69,326,216 (GRCm39) missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69,321,643 (GRCm39) missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5913:Dnah2 UTSW 11 69,339,256 (GRCm39) missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5960:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,321,974 (GRCm39) missense probably damaging 1.00
R5977:Dnah2 UTSW 11 69,411,707 (GRCm39) missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69,391,665 (GRCm39) missense probably benign
R6036:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6036:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6050:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6086:Dnah2 UTSW 11 69,406,834 (GRCm39) missense probably benign 0.30
R6115:Dnah2 UTSW 11 69,337,475 (GRCm39) missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69,409,185 (GRCm39) missense probably benign 0.29
R6159:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6159:Dnah2 UTSW 11 69,349,368 (GRCm39) missense probably damaging 1.00
R6163:Dnah2 UTSW 11 69,411,729 (GRCm39) nonsense probably null
R6171:Dnah2 UTSW 11 69,313,868 (GRCm39) missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69,348,238 (GRCm39) missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69,382,467 (GRCm39) missense probably benign 0.25
R6352:Dnah2 UTSW 11 69,339,053 (GRCm39) missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69,349,344 (GRCm39) missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69,430,241 (GRCm39) missense probably benign
R6478:Dnah2 UTSW 11 69,406,836 (GRCm39) missense probably benign 0.01
R6516:Dnah2 UTSW 11 69,356,212 (GRCm39) missense probably benign 0.34
R6538:Dnah2 UTSW 11 69,328,023 (GRCm39) missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69,314,516 (GRCm39) missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69,346,789 (GRCm39) missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69,320,297 (GRCm39) missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69,375,086 (GRCm39) missense probably benign 0.12
R6935:Dnah2 UTSW 11 69,312,567 (GRCm39) missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69,382,373 (GRCm39) nonsense probably null
R7073:Dnah2 UTSW 11 69,321,318 (GRCm39) nonsense probably null
R7111:Dnah2 UTSW 11 69,337,579 (GRCm39) splice site probably null
R7125:Dnah2 UTSW 11 69,327,008 (GRCm39) missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69,382,381 (GRCm39) missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69,439,923 (GRCm39) splice site probably null
R7214:Dnah2 UTSW 11 69,321,935 (GRCm39) missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69,312,222 (GRCm39) missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69,349,972 (GRCm39) critical splice donor site probably null
R7256:Dnah2 UTSW 11 69,321,920 (GRCm39) missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69,391,643 (GRCm39) missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69,369,623 (GRCm39) missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69,383,631 (GRCm39) missense probably benign 0.25
R7437:Dnah2 UTSW 11 69,389,453 (GRCm39) missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69,439,816 (GRCm39) critical splice donor site probably null
R7473:Dnah2 UTSW 11 69,382,484 (GRCm39) missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69,391,622 (GRCm39) missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69,439,816 (GRCm39) critical splice donor site probably null
R7615:Dnah2 UTSW 11 69,326,130 (GRCm39) missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69,389,511 (GRCm39) missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69,342,144 (GRCm39) nonsense probably null
R7764:Dnah2 UTSW 11 69,348,984 (GRCm39) missense probably benign 0.29
R7793:Dnah2 UTSW 11 69,386,040 (GRCm39) missense probably benign 0.00
R7819:Dnah2 UTSW 11 69,407,419 (GRCm39) missense probably benign 0.01
R7881:Dnah2 UTSW 11 69,322,064 (GRCm39) missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69,409,254 (GRCm39) missense probably damaging 1.00
R7916:Dnah2 UTSW 11 69,311,974 (GRCm39) critical splice acceptor site probably null
R7921:Dnah2 UTSW 11 69,411,660 (GRCm39) missense probably benign
R7928:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
R7937:Dnah2 UTSW 11 69,408,511 (GRCm39) nonsense probably null
R7995:Dnah2 UTSW 11 69,411,563 (GRCm39) missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69,369,649 (GRCm39) missense probably benign 0.00
R8208:Dnah2 UTSW 11 69,411,678 (GRCm39) missense probably benign 0.05
R8215:Dnah2 UTSW 11 69,326,193 (GRCm39) missense probably damaging 1.00
R8279:Dnah2 UTSW 11 69,366,399 (GRCm39) missense probably damaging 1.00
R8338:Dnah2 UTSW 11 69,378,122 (GRCm39) missense probably damaging 1.00
R8348:Dnah2 UTSW 11 69,320,273 (GRCm39) missense possibly damaging 0.95
R8405:Dnah2 UTSW 11 69,349,289 (GRCm39) missense probably damaging 1.00
R8407:Dnah2 UTSW 11 69,350,104 (GRCm39) missense probably benign 0.00
R8493:Dnah2 UTSW 11 69,343,804 (GRCm39) missense probably damaging 1.00
R8673:Dnah2 UTSW 11 69,405,523 (GRCm39) missense probably benign 0.23
R8725:Dnah2 UTSW 11 69,415,005 (GRCm39) missense probably damaging 1.00
R8727:Dnah2 UTSW 11 69,415,005 (GRCm39) missense probably damaging 1.00
R8730:Dnah2 UTSW 11 69,384,087 (GRCm39) missense possibly damaging 0.73
R8804:Dnah2 UTSW 11 69,356,511 (GRCm39) missense probably benign 0.01
R8876:Dnah2 UTSW 11 69,382,348 (GRCm39) missense probably damaging 1.00
R8894:Dnah2 UTSW 11 69,383,048 (GRCm39) missense probably benign 0.01
R8938:Dnah2 UTSW 11 69,328,754 (GRCm39) missense probably damaging 0.99
R9044:Dnah2 UTSW 11 69,420,247 (GRCm39) missense probably benign
R9085:Dnah2 UTSW 11 69,320,224 (GRCm39) missense possibly damaging 0.69
R9110:Dnah2 UTSW 11 69,435,208 (GRCm39) missense probably benign
R9156:Dnah2 UTSW 11 69,313,687 (GRCm39) missense
R9251:Dnah2 UTSW 11 69,406,619 (GRCm39) missense probably damaging 1.00
R9258:Dnah2 UTSW 11 69,368,079 (GRCm39) missense probably damaging 1.00
R9279:Dnah2 UTSW 11 69,409,104 (GRCm39) missense probably benign 0.01
R9318:Dnah2 UTSW 11 69,375,155 (GRCm39) missense probably benign 0.07
R9321:Dnah2 UTSW 11 69,338,939 (GRCm39) critical splice donor site probably null
R9350:Dnah2 UTSW 11 69,384,073 (GRCm39) missense probably benign 0.10
R9358:Dnah2 UTSW 11 69,406,592 (GRCm39) missense probably damaging 0.99
R9417:Dnah2 UTSW 11 69,326,990 (GRCm39) missense probably damaging 1.00
R9420:Dnah2 UTSW 11 69,368,942 (GRCm39) missense probably benign 0.09
R9438:Dnah2 UTSW 11 69,364,220 (GRCm39) missense probably damaging 1.00
R9469:Dnah2 UTSW 11 69,321,896 (GRCm39) missense probably damaging 1.00
R9495:Dnah2 UTSW 11 69,345,208 (GRCm39) missense possibly damaging 0.89
R9579:Dnah2 UTSW 11 69,368,041 (GRCm39) missense probably damaging 1.00
R9608:Dnah2 UTSW 11 69,344,888 (GRCm39) missense probably null 1.00
R9651:Dnah2 UTSW 11 69,341,824 (GRCm39) critical splice donor site probably null
R9662:Dnah2 UTSW 11 69,343,763 (GRCm39) missense probably benign
RF004:Dnah2 UTSW 11 69,328,013 (GRCm39) missense probably benign 0.24
U24488:Dnah2 UTSW 11 69,374,648 (GRCm39) missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69,339,388 (GRCm39) missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69,321,619 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,312,647 (GRCm39) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,407,349 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,407,307 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,389,493 (GRCm39) missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69,377,880 (GRCm39) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,341,946 (GRCm39) missense probably benign
Z1177:Dnah2 UTSW 11 69,435,383 (GRCm39) critical splice acceptor site probably null
Z1177:Dnah2 UTSW 11 69,354,279 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CATGACTCTGTCTATGCGTCG -3'
(R):5'- AGTGCTGCTCTTGGACACTTTC -3'

Sequencing Primer
(F):5'- TCTGTCTATGCGTCGCCGAAG -3'
(R):5'- ACACTTTCCACAGGCTGG -3'
Posted On 2022-07-18