Incidental Mutation 'R9487:Pxdn'
ID 716690
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Name peroxidasin
Synonyms VPO1, 2310075M15Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock # R9487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 29937608-30017658 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29994553 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 510 (V510D)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
AlphaFold Q3UQ28
Predicted Effect possibly damaging
Transcript: ENSMUST00000122328
AA Change: V510D

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: V510D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000220271
AA Change: V330D

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik C T 1: 53,182,506 D55N possibly damaging Het
Abcc2 G A 19: 43,818,032 G762S probably damaging Het
Acta2 C A 19: 34,248,465 A110S probably damaging Het
Adam26a T C 8: 43,569,419 T345A possibly damaging Het
Anapc11 T C 11: 120,605,424 *85R probably null Het
Ang2 A C 14: 51,195,614 C104G probably damaging Het
Ankzf1 G A 1: 75,197,952 V529I probably benign Het
Aox4 G T 1: 58,248,938 V737F probably benign Het
Aqr T C 2: 114,104,047 N1371S probably benign Het
Bach1 T A 16: 87,729,845 S732T probably benign Het
Bcr T A 10: 75,131,599 I555N probably damaging Het
Bicra T C 7: 15,971,792 T1575A probably damaging Het
Bop1 A G 15: 76,453,876 L598P probably damaging Het
Cacna1d A T 14: 30,123,462 F605L possibly damaging Het
Capn15 C T 17: 25,965,379 V109I possibly damaging Het
Cdkn1b T C 6: 134,920,852 probably benign Het
Dnah2 T C 11: 69,515,791 T542A possibly damaging Het
Dsc2 A T 18: 20,047,219 I159N probably damaging Het
Ecel1 A T 1: 87,147,994 V774E probably damaging Het
Eif5b T G 1: 38,045,479 C849W probably damaging Het
Eif5b T A 1: 38,019,370 L251* probably null Het
Ext2 T C 2: 93,762,611 D416G probably damaging Het
Fancm G A 12: 65,106,614 W1281* probably null Het
Flvcr1 A T 1: 191,011,632 I409K possibly damaging Het
Foxk1 T C 5: 142,451,634 probably null Het
Frem2 T A 3: 53,653,484 I1201F possibly damaging Het
Gabra5 A G 7: 57,508,125 probably benign Het
Gm340 C A 19: 41,585,246 N813K probably damaging Het
Gmpr2 G A 14: 55,678,321 V319I probably damaging Het
Gna12 A T 5: 140,760,583 L369Q probably damaging Het
Gpr160 A G 3: 30,896,765 R329G probably benign Het
H2-M10.3 T C 17: 36,366,531 H285R probably benign Het
H2-M2 A T 17: 37,482,533 V194E probably benign Het
Hephl1 G A 9: 15,084,534 R431W possibly damaging Het
Hr A G 14: 70,556,765 H126R possibly damaging Het
Hr A G 14: 70,556,437 T46A probably benign Het
Hsf1 T G 15: 76,498,198 D256E probably benign Het
Ifi208 C T 1: 173,683,395 T372I probably damaging Het
Ifi47 T G 11: 49,095,793 F129C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Itga11 A T 9: 62,762,889 N765I probably benign Het
Klhl22 T A 16: 17,771,799 I108K probably benign Het
Lancl1 T G 1: 67,034,222 H34P probably benign Het
Lrmp A G 6: 145,174,531 I491V probably benign Het
Mbd3l1 G A 9: 18,484,978 G133D probably benign Het
Med12l T C 3: 59,247,932 F1178L probably benign Het
Mrm1 A T 11: 84,814,705 N289K probably damaging Het
Myf6 A G 10: 107,494,212 Y165H probably benign Het
Myo1g C A 11: 6,506,913 C971F probably benign Het
Myo3a T C 2: 22,241,051 M3T probably benign Het
Nsrp1 G A 11: 77,046,288 R361* probably null Het
Olfr1055 T A 2: 86,347,502 D88V probably benign Het
Olfr1241 T C 2: 89,482,412 H241R probably damaging Het
Olfr1250 T C 2: 89,657,387 D18G probably damaging Het
Olfr478 A T 7: 108,031,956 I129N possibly damaging Het
Olfr55 C A 17: 33,176,574 H57Q possibly damaging Het
Olfr890 G A 9: 38,143,570 C140Y probably benign Het
Olfr963 A C 9: 39,669,315 Q86P possibly damaging Het
Oscar T G 7: 3,611,664 Y103S probably damaging Het
Pdpr A G 8: 111,126,293 N610S probably benign Het
Ppp4r3b T C 11: 29,174,697 I56T probably damaging Het
Rab11fip5 T C 6: 85,347,931 S465G possibly damaging Het
Rasgrf2 T C 13: 92,131,251 T82A probably benign Het
Scmh1 G A 4: 120,463,087 W30* probably null Het
Sema4g T C 19: 44,992,632 Y40H probably benign Het
Serpinf2 A T 11: 75,432,668 M404K probably damaging Het
Sgk3 T C 1: 9,880,391 probably null Het
Slc16a5 A T 11: 115,469,912 Y307F possibly damaging Het
Slc39a5 G A 10: 128,397,759 L290F probably damaging Het
Snx32 A C 19: 5,497,708 D191E probably damaging Het
Sp4 T C 12: 118,299,124 I396V probably benign Het
Srrd A G 5: 112,342,899 V42A unknown Het
Stim1 A G 7: 102,431,050 H547R unknown Het
Svep1 G A 4: 58,070,517 A2423V probably benign Het
Tep1 A G 14: 50,829,230 S2304P possibly damaging Het
Tkt T C 14: 30,559,839 S105P probably damaging Het
Tkt C G 14: 30,559,838 S104R probably benign Het
Tln1 A T 4: 43,542,893 N1365K probably damaging Het
Topaz1 G T 9: 122,775,642 A1104S probably benign Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttll10 G T 4: 156,043,159 T389K probably benign Het
Tubal3 A G 13: 3,930,674 I129V probably benign Het
Ucp3 A G 7: 100,481,916 E192G probably damaging Het
Usp47 A G 7: 112,077,856 D448G probably damaging Het
Vmn2r98 T A 17: 19,081,234 L833M possibly damaging Het
Vps13d A G 4: 145,081,299 probably null Het
Wdr7 A G 18: 63,777,868 D777G possibly damaging Het
Zcchc8 A G 5: 123,709,237 I213T probably damaging Het
Zfp281 T C 1: 136,627,405 I707T probably damaging Het
Zfp335 T C 2: 164,893,475 H1158R probably damaging Het
Zfp692 C T 11: 58,308,939 T118M probably damaging Het
Zfr2 T A 10: 81,240,135 L192Q probably benign Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
R8903:Pxdn UTSW 12 29990993 missense probably benign
R9310:Pxdn UTSW 12 30002052 missense probably damaging 1.00
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGGAAGCCTCTGTGTC -3'
(R):5'- TGAGGCCAGCATGACATGAG -3'

Sequencing Primer
(F):5'- AAGCCTCTGTGTCCAGGGTG -3'
(R):5'- AGTGTCTGTTCAAATCCCTCATGAAC -3'
Posted On 2022-07-18