Mutagenetix > Incidental Mutation

Incidental Mutation 'R9487:Hr'

716702

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000022096

Gene Name

hairless

Synonyms

ALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9487 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70552212-70573548 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70556765 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 126 (H126R)

Ref Sequence

ENSEMBL: ENSMUSP00000124816 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]

AlphaFold

Q61645

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022691
AA Change: H126R

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: H126R

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161069
AA Change: H126R

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: H126R

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163060
AA Change: H155R

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: H155R

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Blast:JmjC	83	878	N/A	BLAST
JmjC	968	1179	5.23e-38	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	C	T	1: 53,182,506	D55N	possibly damaging	Het
Abcc2	G	A	19: 43,818,032	G762S	probably damaging	Het
Acta2	C	A	19: 34,248,465	A110S	probably damaging	Het
Adam26a	T	C	8: 43,569,419	T345A	possibly damaging	Het
Anapc11	T	C	11: 120,605,424	*85R	probably null	Het
Ang2	A	C	14: 51,195,614	C104G	probably damaging	Het
Ankzf1	G	A	1: 75,197,952	V529I	probably benign	Het
Aox4	G	T	1: 58,248,938	V737F	probably benign	Het
Aqr	T	C	2: 114,104,047	N1371S	probably benign	Het
Bach1	T	A	16: 87,729,845	S732T	probably benign	Het
Bcr	T	A	10: 75,131,599	I555N	probably damaging	Het
Bicra	T	C	7: 15,971,792	T1575A	probably damaging	Het
Bop1	A	G	15: 76,453,876	L598P	probably damaging	Het
Cacna1d	A	T	14: 30,123,462	F605L	possibly damaging	Het
Capn15	C	T	17: 25,965,379	V109I	possibly damaging	Het
Cdkn1b	T	C	6: 134,920,852		probably benign	Het
Dnah2	T	C	11: 69,515,791	T542A	possibly damaging	Het
Dsc2	A	T	18: 20,047,219	I159N	probably damaging	Het
Ecel1	A	T	1: 87,147,994	V774E	probably damaging	Het
Eif5b	T	A	1: 38,019,370	L251*	probably null	Het
Eif5b	T	G	1: 38,045,479	C849W	probably damaging	Het
Ext2	T	C	2: 93,762,611	D416G	probably damaging	Het
Fancm	G	A	12: 65,106,614	W1281*	probably null	Het
Flvcr1	A	T	1: 191,011,632	I409K	possibly damaging	Het
Foxk1	T	C	5: 142,451,634		probably null	Het
Frem2	T	A	3: 53,653,484	I1201F	possibly damaging	Het
Gabra5	A	G	7: 57,508,125		probably benign	Het
Gm340	C	A	19: 41,585,246	N813K	probably damaging	Het
Gmpr2	G	A	14: 55,678,321	V319I	probably damaging	Het
Gna12	A	T	5: 140,760,583	L369Q	probably damaging	Het
Gpr160	A	G	3: 30,896,765	R329G	probably benign	Het
H2-M10.3	T	C	17: 36,366,531	H285R	probably benign	Het
H2-M2	A	T	17: 37,482,533	V194E	probably benign	Het
Hephl1	G	A	9: 15,084,534	R431W	possibly damaging	Het
Hsf1	T	G	15: 76,498,198	D256E	probably benign	Het
Ifi208	C	T	1: 173,683,395	T372I	probably damaging	Het
Ifi47	T	G	11: 49,095,793	F129C	probably damaging	Het
Il1rl2	CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT	CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT	1: 40,327,310		probably benign	Het
Itga11	A	T	9: 62,762,889	N765I	probably benign	Het
Klhl22	T	A	16: 17,771,799	I108K	probably benign	Het
Lancl1	T	G	1: 67,034,222	H34P	probably benign	Het
Lrmp	A	G	6: 145,174,531	I491V	probably benign	Het
Mbd3l1	G	A	9: 18,484,978	G133D	probably benign	Het
Med12l	T	C	3: 59,247,932	F1178L	probably benign	Het
Mrm1	A	T	11: 84,814,705	N289K	probably damaging	Het
Myf6	A	G	10: 107,494,212	Y165H	probably benign	Het
Myo1g	C	A	11: 6,506,913	C971F	probably benign	Het
Myo3a	T	C	2: 22,241,051	M3T	probably benign	Het
Nsrp1	G	A	11: 77,046,288	R361*	probably null	Het
Olfr1055	T	A	2: 86,347,502	D88V	probably benign	Het
Olfr1241	T	C	2: 89,482,412	H241R	probably damaging	Het
Olfr1250	T	C	2: 89,657,387	D18G	probably damaging	Het
Olfr478	A	T	7: 108,031,956	I129N	possibly damaging	Het
Olfr55	C	A	17: 33,176,574	H57Q	possibly damaging	Het
Olfr890	G	A	9: 38,143,570	C140Y	probably benign	Het
Olfr963	A	C	9: 39,669,315	Q86P	possibly damaging	Het
Oscar	T	G	7: 3,611,664	Y103S	probably damaging	Het
Pdpr	A	G	8: 111,126,293	N610S	probably benign	Het
Ppp4r3b	T	C	11: 29,174,697	I56T	probably damaging	Het
Pxdn	T	A	12: 29,994,553	V510D	possibly damaging	Het
Rab11fip5	T	C	6: 85,347,931	S465G	possibly damaging	Het
Rasgrf2	T	C	13: 92,131,251	T82A	probably benign	Het
Scmh1	G	A	4: 120,463,087	W30*	probably null	Het
Sema4g	T	C	19: 44,992,632	Y40H	probably benign	Het
Serpinf2	A	T	11: 75,432,668	M404K	probably damaging	Het
Sgk3	T	C	1: 9,880,391		probably null	Het
Slc16a5	A	T	11: 115,469,912	Y307F	possibly damaging	Het
Slc39a5	G	A	10: 128,397,759	L290F	probably damaging	Het
Snx32	A	C	19: 5,497,708	D191E	probably damaging	Het
Sp4	T	C	12: 118,299,124	I396V	probably benign	Het
Srrd	A	G	5: 112,342,899	V42A	unknown	Het
Stim1	A	G	7: 102,431,050	H547R	unknown	Het
Svep1	G	A	4: 58,070,517	A2423V	probably benign	Het
Tep1	A	G	14: 50,829,230	S2304P	possibly damaging	Het
Tkt	C	G	14: 30,559,838	S104R	probably benign	Het
Tkt	T	C	14: 30,559,839	S105P	probably damaging	Het
Tln1	A	T	4: 43,542,893	N1365K	probably damaging	Het
Topaz1	G	T	9: 122,775,642	A1104S	probably benign	Het
Trmt2a	A	G	16: 18,250,950	H270R	probably damaging	Het
Ttll10	G	T	4: 156,043,159	T389K	probably benign	Het
Tubal3	A	G	13: 3,930,674	I129V	probably benign	Het
Ucp3	A	G	7: 100,481,916	E192G	probably damaging	Het
Usp47	A	G	7: 112,077,856	D448G	probably damaging	Het
Vmn2r98	T	A	17: 19,081,234	L833M	possibly damaging	Het
Vps13d	A	G	4: 145,081,299		probably null	Het
Wdr7	A	G	18: 63,777,868	D777G	possibly damaging	Het
Zcchc8	A	G	5: 123,709,237	I213T	probably damaging	Het
Zfp281	T	C	1: 136,627,405	I707T	probably damaging	Het
Zfp335	T	C	2: 164,893,475	H1158R	probably damaging	Het
Zfp692	C	T	11: 58,308,939	T118M	probably damaging	Het
Zfr2	T	A	10: 81,240,135	L192Q	probably benign	Het

Other mutations in Hr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01805:Hr	APN	14	70565297	splice site	probably benign
IGL02020:Hr	APN	14	70556437	missense	probably benign	0.01
IGL02372:Hr	APN	14	70558350	missense	possibly damaging	0.94
IGL02380:Hr	APN	14	70557761	missense	probably damaging	0.98
IGL02554:Hr	APN	14	70559866	splice site	probably benign
IGL02949:Hr	APN	14	70559785	missense	possibly damaging	0.87
IGL03406:Hr	APN	14	70563420	critical splice donor site	probably null
angie	UTSW	14	70567833	missense	probably damaging	0.97
blofeld	UTSW	14	70568085	missense	probably damaging	1.00
general	UTSW	14	70563684	critical splice donor site	probably null
kaburo	UTSW	14		unclassified
mister_clean	UTSW	14	70560064	critical splice donor site	probably benign
mushroom	UTSW	14	70568085	missense	probably damaging	1.00
prune	UTSW	14	70571429	missense	probably damaging	1.00
ren	UTSW	14	70568085	missense	probably damaging	1.00
subclinical	UTSW	14	70561836	missense	possibly damaging	0.89
vessel	UTSW	14	70561865	nonsense	probably null
yuanxiao	UTSW	14	70571448	missense	probably damaging	1.00
R0018:Hr	UTSW	14	70558277	missense	probably benign
R0038:Hr	UTSW	14	70568085	missense	probably damaging	1.00
R0374:Hr	UTSW	14	70556476	missense	probably benign	0.01
R0511:Hr	UTSW	14	70561912	nonsense	probably null
R0609:Hr	UTSW	14	70559657	missense	probably benign
R1828:Hr	UTSW	14	70572037	critical splice donor site	probably null
R2030:Hr	UTSW	14	70571448	missense	probably damaging	1.00
R2266:Hr	UTSW	14	70558107	missense	probably benign
R2267:Hr	UTSW	14	70558107	missense	probably benign
R2268:Hr	UTSW	14	70558107	missense	probably benign
R2377:Hr	UTSW	14	70557878	missense	probably damaging	1.00
R3686:Hr	UTSW	14	70557796	missense	probably damaging	0.98
R3687:Hr	UTSW	14	70557796	missense	probably damaging	0.98
R3754:Hr	UTSW	14	70567824	missense	probably damaging	1.00
R3803:Hr	UTSW	14	70557893	missense	probably benign	0.01
R3846:Hr	UTSW	14	70571453	missense	probably damaging	1.00
R3977:Hr	UTSW	14	70563584	missense	probably benign	0.01
R3978:Hr	UTSW	14	70563584	missense	probably benign	0.01
R3979:Hr	UTSW	14	70563584	missense	probably benign	0.01
R4528:Hr	UTSW	14	70566383	missense	probably damaging	1.00
R4654:Hr	UTSW	14	70563573	missense	probably damaging	0.99
R4834:Hr	UTSW	14	70559922	missense	probably damaging	0.98
R4847:Hr	UTSW	14	70556476	missense	probably benign	0.04
R4863:Hr	UTSW	14	70571972	missense	probably damaging	1.00
R5292:Hr	UTSW	14	70571992	missense	probably damaging	1.00
R5452:Hr	UTSW	14	70556627	missense	probably damaging	1.00
R5717:Hr	UTSW	14	70566176	missense	probably benign	0.34
R5902:Hr	UTSW	14	70557791	missense	probably benign	0.02
R6000:Hr	UTSW	14	70567833	missense	probably damaging	0.97
R6439:Hr	UTSW	14	70561836	missense	possibly damaging	0.89
R6823:Hr	UTSW	14	70565374	missense	probably damaging	0.98
R7030:Hr	UTSW	14	70563684	critical splice donor site	probably null
R7213:Hr	UTSW	14	70558350	missense	probably damaging	0.99
R7452:Hr	UTSW	14	70571486	missense	probably damaging	1.00
R7468:Hr	UTSW	14	70558212	missense	possibly damaging	0.89
R7572:Hr	UTSW	14	70561853	missense	possibly damaging	0.66
R7956:Hr	UTSW	14	70559887	missense	probably benign
R7996:Hr	UTSW	14	70563603	nonsense	probably null
R7997:Hr	UTSW	14	70563603	nonsense	probably null
R8076:Hr	UTSW	14	70557941	missense	probably benign	0.00
R8101:Hr	UTSW	14	70567842	missense	possibly damaging	0.67
R8553:Hr	UTSW	14	70567525	missense	probably damaging	1.00
R8749:Hr	UTSW	14	70558070	missense	probably damaging	1.00
R8850:Hr	UTSW	14	70561865	nonsense	probably null
R8949:Hr	UTSW	14	70557888	missense	probably benign	0.01
R9139:Hr	UTSW	14	70557639	missense	possibly damaging	0.65
R9236:Hr	UTSW	14	70571956	missense	probably damaging	1.00
R9246:Hr	UTSW	14	70571475	missense	probably damaging	1.00
R9327:Hr	UTSW	14	70567788	missense	possibly damaging	0.91
R9337:Hr	UTSW	14	70559884	missense	probably benign	0.00
R9487:Hr	UTSW	14	70556437	missense	probably benign	0.01
R9700:Hr	UTSW	14	70567176	missense	probably benign	0.00
X0025:Hr	UTSW	14	70566951	splice site	probably null
X0026:Hr	UTSW	14	70567841	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGGACACACTCTCACTGGTG -3'
(R):5'- CACTCACCTTGCTGCCTAAG -3'

Sequencing Primer
(F):5'- ACACTCTCACTGGTGGAGGG -3'
(R):5'- TGGCTCCCAGAGTATACCCATG -3'

Posted On

2022-07-18