Incidental Mutation 'R9487:Trmt2a'
ID 716706
Institutional Source Beutler Lab
Gene Symbol Trmt2a
Ensembl Gene ENSMUSG00000022721
Gene Name TRM2 tRNA methyltransferase 2A
Synonyms Htf9c
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 18248679-18254772 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18250950 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 270 (H270R)
Ref Sequence ENSEMBL: ENSMUSP00000111303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009321] [ENSMUST00000052325] [ENSMUST00000100099] [ENSMUST00000115633] [ENSMUST00000115640] [ENSMUST00000115645] [ENSMUST00000128045] [ENSMUST00000140206] [ENSMUST00000231509]
AlphaFold Q8BNV1
Predicted Effect probably benign
Transcript: ENSMUST00000009321
SMART Domains Protein: ENSMUSP00000009321
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052325
SMART Domains Protein: ENSMUSP00000055288
Gene: ENSMUSG00000005732

DomainStartEndE-ValueType
RanBD 1 108 4.92e-46 SMART
coiled coil region 123 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059696
Predicted Effect probably damaging
Transcript: ENSMUST00000100099
AA Change: H270R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111303
Gene: ENSMUSG00000022721
AA Change: H270R

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 1.2e-20 PFAM
Pfam:PCMT 386 482 1.1e-8 PFAM
Pfam:MTS 389 489 6.2e-9 PFAM
Pfam:Methyltransf_4 397 497 4.2e-7 PFAM
Pfam:Methyltransf_31 420 546 6.2e-15 PFAM
Pfam:Methyltransf_18 422 523 9.3e-11 PFAM
Pfam:Methyltransf_26 423 538 5.3e-12 PFAM
Pfam:Methyltransf_25 426 511 3.5e-8 PFAM
Pfam:Methyltransf_11 427 487 5.6e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115633
SMART Domains Protein: ENSMUSP00000111296
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115640
AA Change: H270R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111304
Gene: ENSMUSG00000022721
AA Change: H270R

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 2.6e-20 PFAM
Pfam:PCMT 386 482 3.4e-9 PFAM
Pfam:MTS 392 489 1e-7 PFAM
Pfam:Cons_hypoth95 405 542 2.7e-7 PFAM
Pfam:Methyltransf_31 420 547 2.1e-15 PFAM
Pfam:Methyltransf_18 422 526 2.9e-12 PFAM
Pfam:Methyltransf_4 423 499 2.6e-7 PFAM
Pfam:Methyltransf_25 426 511 1.3e-8 PFAM
Pfam:Methyltransf_11 427 489 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115645
SMART Domains Protein: ENSMUSP00000111309
Gene: ENSMUSG00000005732

DomainStartEndE-ValueType
RanBD 27 158 3.33e-75 SMART
low complexity region 183 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127239
Predicted Effect probably benign
Transcript: ENSMUST00000128045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134035
Predicted Effect
SMART Domains Protein: ENSMUSP00000117026
Gene: ENSMUSG00000022721
AA Change: H84R

DomainStartEndE-ValueType
Pfam:PCMT 118 220 4.2e-7 PFAM
Pfam:tRNA_U5-meth_tr 118 280 4e-16 PFAM
Pfam:MTS 129 229 5.4e-6 PFAM
Pfam:Cons_hypoth95 143 277 6.5e-5 PFAM
Pfam:PrmA 146 234 2e-4 PFAM
Pfam:Ubie_methyltran 148 223 1e-4 PFAM
Pfam:Methyltransf_31 158 271 6.1e-14 PFAM
Pfam:Methyltransf_18 160 263 8.3e-11 PFAM
Pfam:Methyltransf_4 161 237 7.1e-5 PFAM
Pfam:Methyltransf_26 161 274 2e-6 PFAM
Pfam:Methyltransf_25 164 251 5.2e-7 PFAM
Pfam:Methyltransf_11 165 227 9.4e-7 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121216
Gene: ENSMUSG00000022721
AA Change: H270R

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 383 481 3.7e-8 PFAM
Pfam:PCMT 386 481 1.5e-6 PFAM
Pfam:MTS 389 493 2.5e-7 PFAM
Pfam:Methyltransf_31 420 491 1.5e-9 PFAM
Pfam:Methyltransf_18 422 508 4.1e-8 PFAM
Pfam:Methyltransf_26 423 523 3.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144536
Predicted Effect probably benign
Transcript: ENSMUST00000232144
Predicted Effect probably benign
Transcript: ENSMUST00000232293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232342
Predicted Effect probably benign
Transcript: ENSMUST00000231509
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is of unknown function. However, it is orthologous to the mouse Trmt2a gene and contains an RNA methyltransferase domain. Expression of this gene varies during the cell cycle, with aberrant expression being a possible biomarker in certain breast cancers. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik C T 1: 53,182,506 D55N possibly damaging Het
Abcc2 G A 19: 43,818,032 G762S probably damaging Het
Acta2 C A 19: 34,248,465 A110S probably damaging Het
Adam26a T C 8: 43,569,419 T345A possibly damaging Het
Anapc11 T C 11: 120,605,424 *85R probably null Het
Ang2 A C 14: 51,195,614 C104G probably damaging Het
Ankzf1 G A 1: 75,197,952 V529I probably benign Het
Aox4 G T 1: 58,248,938 V737F probably benign Het
Aqr T C 2: 114,104,047 N1371S probably benign Het
Bach1 T A 16: 87,729,845 S732T probably benign Het
Bcr T A 10: 75,131,599 I555N probably damaging Het
Bicra T C 7: 15,971,792 T1575A probably damaging Het
Bop1 A G 15: 76,453,876 L598P probably damaging Het
Cacna1d A T 14: 30,123,462 F605L possibly damaging Het
Capn15 C T 17: 25,965,379 V109I possibly damaging Het
Cdkn1b T C 6: 134,920,852 probably benign Het
Dnah2 T C 11: 69,515,791 T542A possibly damaging Het
Dsc2 A T 18: 20,047,219 I159N probably damaging Het
Ecel1 A T 1: 87,147,994 V774E probably damaging Het
Eif5b T A 1: 38,019,370 L251* probably null Het
Eif5b T G 1: 38,045,479 C849W probably damaging Het
Ext2 T C 2: 93,762,611 D416G probably damaging Het
Fancm G A 12: 65,106,614 W1281* probably null Het
Flvcr1 A T 1: 191,011,632 I409K possibly damaging Het
Foxk1 T C 5: 142,451,634 probably null Het
Frem2 T A 3: 53,653,484 I1201F possibly damaging Het
Gabra5 A G 7: 57,508,125 probably benign Het
Gm340 C A 19: 41,585,246 N813K probably damaging Het
Gmpr2 G A 14: 55,678,321 V319I probably damaging Het
Gna12 A T 5: 140,760,583 L369Q probably damaging Het
Gpr160 A G 3: 30,896,765 R329G probably benign Het
H2-M10.3 T C 17: 36,366,531 H285R probably benign Het
H2-M2 A T 17: 37,482,533 V194E probably benign Het
Hephl1 G A 9: 15,084,534 R431W possibly damaging Het
Hr A G 14: 70,556,437 T46A probably benign Het
Hr A G 14: 70,556,765 H126R possibly damaging Het
Hsf1 T G 15: 76,498,198 D256E probably benign Het
Ifi208 C T 1: 173,683,395 T372I probably damaging Het
Ifi47 T G 11: 49,095,793 F129C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Itga11 A T 9: 62,762,889 N765I probably benign Het
Klhl22 T A 16: 17,771,799 I108K probably benign Het
Lancl1 T G 1: 67,034,222 H34P probably benign Het
Lrmp A G 6: 145,174,531 I491V probably benign Het
Mbd3l1 G A 9: 18,484,978 G133D probably benign Het
Med12l T C 3: 59,247,932 F1178L probably benign Het
Mrm1 A T 11: 84,814,705 N289K probably damaging Het
Myf6 A G 10: 107,494,212 Y165H probably benign Het
Myo1g C A 11: 6,506,913 C971F probably benign Het
Myo3a T C 2: 22,241,051 M3T probably benign Het
Nsrp1 G A 11: 77,046,288 R361* probably null Het
Olfr1055 T A 2: 86,347,502 D88V probably benign Het
Olfr1241 T C 2: 89,482,412 H241R probably damaging Het
Olfr1250 T C 2: 89,657,387 D18G probably damaging Het
Olfr478 A T 7: 108,031,956 I129N possibly damaging Het
Olfr55 C A 17: 33,176,574 H57Q possibly damaging Het
Olfr890 G A 9: 38,143,570 C140Y probably benign Het
Olfr963 A C 9: 39,669,315 Q86P possibly damaging Het
Oscar T G 7: 3,611,664 Y103S probably damaging Het
Pdpr A G 8: 111,126,293 N610S probably benign Het
Ppp4r3b T C 11: 29,174,697 I56T probably damaging Het
Pxdn T A 12: 29,994,553 V510D possibly damaging Het
Rab11fip5 T C 6: 85,347,931 S465G possibly damaging Het
Rasgrf2 T C 13: 92,131,251 T82A probably benign Het
Scmh1 G A 4: 120,463,087 W30* probably null Het
Sema4g T C 19: 44,992,632 Y40H probably benign Het
Serpinf2 A T 11: 75,432,668 M404K probably damaging Het
Sgk3 T C 1: 9,880,391 probably null Het
Slc16a5 A T 11: 115,469,912 Y307F possibly damaging Het
Slc39a5 G A 10: 128,397,759 L290F probably damaging Het
Snx32 A C 19: 5,497,708 D191E probably damaging Het
Sp4 T C 12: 118,299,124 I396V probably benign Het
Srrd A G 5: 112,342,899 V42A unknown Het
Stim1 A G 7: 102,431,050 H547R unknown Het
Svep1 G A 4: 58,070,517 A2423V probably benign Het
Tep1 A G 14: 50,829,230 S2304P possibly damaging Het
Tkt C G 14: 30,559,838 S104R probably benign Het
Tkt T C 14: 30,559,839 S105P probably damaging Het
Tln1 A T 4: 43,542,893 N1365K probably damaging Het
Topaz1 G T 9: 122,775,642 A1104S probably benign Het
Ttll10 G T 4: 156,043,159 T389K probably benign Het
Tubal3 A G 13: 3,930,674 I129V probably benign Het
Ucp3 A G 7: 100,481,916 E192G probably damaging Het
Usp47 A G 7: 112,077,856 D448G probably damaging Het
Vmn2r98 T A 17: 19,081,234 L833M possibly damaging Het
Vps13d A G 4: 145,081,299 probably null Het
Wdr7 A G 18: 63,777,868 D777G possibly damaging Het
Zcchc8 A G 5: 123,709,237 I213T probably damaging Het
Zfp281 T C 1: 136,627,405 I707T probably damaging Het
Zfp335 T C 2: 164,893,475 H1158R probably damaging Het
Zfp692 C T 11: 58,308,939 T118M probably damaging Het
Zfr2 T A 10: 81,240,135 L192Q probably benign Het
Other mutations in Trmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Trmt2a APN 16 18249487 missense probably benign
R0050:Trmt2a UTSW 16 18250843 missense probably damaging 1.00
R0050:Trmt2a UTSW 16 18250843 missense probably damaging 1.00
R0377:Trmt2a UTSW 16 18249703 missense possibly damaging 0.68
R0699:Trmt2a UTSW 16 18249529 missense probably benign 0.01
R1034:Trmt2a UTSW 16 18249709 missense probably damaging 1.00
R1114:Trmt2a UTSW 16 18250440 unclassified probably benign
R1882:Trmt2a UTSW 16 18249894 missense possibly damaging 0.88
R1911:Trmt2a UTSW 16 18251206 missense probably benign 0.01
R2184:Trmt2a UTSW 16 18252995 missense probably benign 0.06
R3853:Trmt2a UTSW 16 18251191 missense possibly damaging 0.94
R4427:Trmt2a UTSW 16 18249229 unclassified probably benign
R4737:Trmt2a UTSW 16 18251286 unclassified probably benign
R4896:Trmt2a UTSW 16 18252929 missense probably damaging 0.99
R4903:Trmt2a UTSW 16 18249554 nonsense probably null
R4964:Trmt2a UTSW 16 18249554 nonsense probably null
R4966:Trmt2a UTSW 16 18249554 nonsense probably null
R5216:Trmt2a UTSW 16 18252184 missense probably benign 0.22
R5452:Trmt2a UTSW 16 18250950 missense probably damaging 1.00
R5837:Trmt2a UTSW 16 18249462 unclassified probably benign
R6555:Trmt2a UTSW 16 18253203 missense probably benign 0.03
R6670:Trmt2a UTSW 16 18250477 missense possibly damaging 0.57
R7064:Trmt2a UTSW 16 18253004 missense probably damaging 0.99
R7718:Trmt2a UTSW 16 18250623 missense probably benign 0.16
R8302:Trmt2a UTSW 16 18249949 missense probably damaging 1.00
R8463:Trmt2a UTSW 16 18251175 missense probably damaging 1.00
R9120:Trmt2a UTSW 16 18249858 missense probably damaging 1.00
R9186:Trmt2a UTSW 16 18251169 missense probably benign 0.00
R9710:Trmt2a UTSW 16 18252177 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGTAATCAAGGTTGAGATCTGAC -3'
(R):5'- TGCCGAGTATGGTGTGGAAC -3'

Sequencing Primer
(F):5'- GGTTGAGATCTGACTCTTTACTACAC -3'
(R):5'- CAAATATACTCAGTGTGTGCCC -3'
Posted On 2022-07-18