Incidental Mutation 'R9487:Vmn2r98'
ID 716708
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R9487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19053460-19082411 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19081234 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 833 (L833M)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect possibly damaging
Transcript: ENSMUST00000170424
AA Change: L833M

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: L833M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik C T 1: 53,182,506 D55N possibly damaging Het
Abcc2 G A 19: 43,818,032 G762S probably damaging Het
Acta2 C A 19: 34,248,465 A110S probably damaging Het
Adam26a T C 8: 43,569,419 T345A possibly damaging Het
Anapc11 T C 11: 120,605,424 *85R probably null Het
Ang2 A C 14: 51,195,614 C104G probably damaging Het
Ankzf1 G A 1: 75,197,952 V529I probably benign Het
Aox4 G T 1: 58,248,938 V737F probably benign Het
Aqr T C 2: 114,104,047 N1371S probably benign Het
Bach1 T A 16: 87,729,845 S732T probably benign Het
Bcr T A 10: 75,131,599 I555N probably damaging Het
Bicra T C 7: 15,971,792 T1575A probably damaging Het
Bop1 A G 15: 76,453,876 L598P probably damaging Het
Cacna1d A T 14: 30,123,462 F605L possibly damaging Het
Capn15 C T 17: 25,965,379 V109I possibly damaging Het
Cdkn1b T C 6: 134,920,852 probably benign Het
Dnah2 T C 11: 69,515,791 T542A possibly damaging Het
Dsc2 A T 18: 20,047,219 I159N probably damaging Het
Ecel1 A T 1: 87,147,994 V774E probably damaging Het
Eif5b T A 1: 38,019,370 L251* probably null Het
Eif5b T G 1: 38,045,479 C849W probably damaging Het
Ext2 T C 2: 93,762,611 D416G probably damaging Het
Fancm G A 12: 65,106,614 W1281* probably null Het
Flvcr1 A T 1: 191,011,632 I409K possibly damaging Het
Foxk1 T C 5: 142,451,634 probably null Het
Frem2 T A 3: 53,653,484 I1201F possibly damaging Het
Gabra5 A G 7: 57,508,125 probably benign Het
Gm340 C A 19: 41,585,246 N813K probably damaging Het
Gmpr2 G A 14: 55,678,321 V319I probably damaging Het
Gna12 A T 5: 140,760,583 L369Q probably damaging Het
Gpr160 A G 3: 30,896,765 R329G probably benign Het
H2-M10.3 T C 17: 36,366,531 H285R probably benign Het
H2-M2 A T 17: 37,482,533 V194E probably benign Het
Hephl1 G A 9: 15,084,534 R431W possibly damaging Het
Hr A G 14: 70,556,437 T46A probably benign Het
Hr A G 14: 70,556,765 H126R possibly damaging Het
Hsf1 T G 15: 76,498,198 D256E probably benign Het
Ifi208 C T 1: 173,683,395 T372I probably damaging Het
Ifi47 T G 11: 49,095,793 F129C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Itga11 A T 9: 62,762,889 N765I probably benign Het
Klhl22 T A 16: 17,771,799 I108K probably benign Het
Lancl1 T G 1: 67,034,222 H34P probably benign Het
Lrmp A G 6: 145,174,531 I491V probably benign Het
Mbd3l1 G A 9: 18,484,978 G133D probably benign Het
Med12l T C 3: 59,247,932 F1178L probably benign Het
Mrm1 A T 11: 84,814,705 N289K probably damaging Het
Myf6 A G 10: 107,494,212 Y165H probably benign Het
Myo1g C A 11: 6,506,913 C971F probably benign Het
Myo3a T C 2: 22,241,051 M3T probably benign Het
Nsrp1 G A 11: 77,046,288 R361* probably null Het
Olfr1055 T A 2: 86,347,502 D88V probably benign Het
Olfr1241 T C 2: 89,482,412 H241R probably damaging Het
Olfr1250 T C 2: 89,657,387 D18G probably damaging Het
Olfr478 A T 7: 108,031,956 I129N possibly damaging Het
Olfr55 C A 17: 33,176,574 H57Q possibly damaging Het
Olfr890 G A 9: 38,143,570 C140Y probably benign Het
Olfr963 A C 9: 39,669,315 Q86P possibly damaging Het
Oscar T G 7: 3,611,664 Y103S probably damaging Het
Pdpr A G 8: 111,126,293 N610S probably benign Het
Ppp4r3b T C 11: 29,174,697 I56T probably damaging Het
Pxdn T A 12: 29,994,553 V510D possibly damaging Het
Rab11fip5 T C 6: 85,347,931 S465G possibly damaging Het
Rasgrf2 T C 13: 92,131,251 T82A probably benign Het
Scmh1 G A 4: 120,463,087 W30* probably null Het
Sema4g T C 19: 44,992,632 Y40H probably benign Het
Serpinf2 A T 11: 75,432,668 M404K probably damaging Het
Sgk3 T C 1: 9,880,391 probably null Het
Slc16a5 A T 11: 115,469,912 Y307F possibly damaging Het
Slc39a5 G A 10: 128,397,759 L290F probably damaging Het
Snx32 A C 19: 5,497,708 D191E probably damaging Het
Sp4 T C 12: 118,299,124 I396V probably benign Het
Srrd A G 5: 112,342,899 V42A unknown Het
Stim1 A G 7: 102,431,050 H547R unknown Het
Svep1 G A 4: 58,070,517 A2423V probably benign Het
Tep1 A G 14: 50,829,230 S2304P possibly damaging Het
Tkt C G 14: 30,559,838 S104R probably benign Het
Tkt T C 14: 30,559,839 S105P probably damaging Het
Tln1 A T 4: 43,542,893 N1365K probably damaging Het
Topaz1 G T 9: 122,775,642 A1104S probably benign Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttll10 G T 4: 156,043,159 T389K probably benign Het
Tubal3 A G 13: 3,930,674 I129V probably benign Het
Ucp3 A G 7: 100,481,916 E192G probably damaging Het
Usp47 A G 7: 112,077,856 D448G probably damaging Het
Vps13d A G 4: 145,081,299 probably null Het
Wdr7 A G 18: 63,777,868 D777G possibly damaging Het
Zcchc8 A G 5: 123,709,237 I213T probably damaging Het
Zfp281 T C 1: 136,627,405 I707T probably damaging Het
Zfp335 T C 2: 164,893,475 H1158R probably damaging Het
Zfp692 C T 11: 58,308,939 T118M probably damaging Het
Zfr2 T A 10: 81,240,135 L192Q probably benign Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19080535 missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19067198 splice site probably null
R7915:Vmn2r98 UTSW 17 19067231 missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19053650 missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19081163 missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19080769 missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19066270 missense probably benign
R8952:Vmn2r98 UTSW 17 19065269 missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19081219 missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19066515 missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19067255 missense probably benign 0.01
R9753:Vmn2r98 UTSW 17 19065403 missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19065136 critical splice acceptor site probably null
Z1177:Vmn2r98 UTSW 17 19067423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCATGGCCTTCTTGTCTAG -3'
(R):5'- GGCATCAGGTCTTAGATTCAGAG -3'

Sequencing Primer
(F):5'- GGCCTTCTTGTCTAGAAATTTGCCAG -3'
(R):5'- CAGGTCTTAGATTCAGAGAAGCTTTG -3'
Posted On 2022-07-18