Incidental Mutation 'R9487:Vmn2r98'
ID 716708
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R9487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19273755-19301573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19301496 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 833 (L833M)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect possibly damaging
Transcript: ENSMUST00000170424
AA Change: L833M

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: L833M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik C T 1: 53,221,665 (GRCm39) D55N possibly damaging Het
Abcc2 G A 19: 43,806,471 (GRCm39) G762S probably damaging Het
Acta2 C A 19: 34,225,865 (GRCm39) A110S probably damaging Het
Adam26a T C 8: 44,022,456 (GRCm39) T345A possibly damaging Het
Anapc11 T C 11: 120,496,250 (GRCm39) *85R probably null Het
Ang2 A C 14: 51,433,071 (GRCm39) C104G probably damaging Het
Ankzf1 G A 1: 75,174,596 (GRCm39) V529I probably benign Het
Aox4 G T 1: 58,288,097 (GRCm39) V737F probably benign Het
Aqr T C 2: 113,934,528 (GRCm39) N1371S probably benign Het
Bach1 T A 16: 87,526,733 (GRCm39) S732T probably benign Het
Bcr T A 10: 74,967,431 (GRCm39) I555N probably damaging Het
Bicra T C 7: 15,705,717 (GRCm39) T1575A probably damaging Het
Bop1 A G 15: 76,338,076 (GRCm39) L598P probably damaging Het
Cacna1d A T 14: 29,845,419 (GRCm39) F605L possibly damaging Het
Capn15 C T 17: 26,184,353 (GRCm39) V109I possibly damaging Het
Cdkn1b T C 6: 134,897,815 (GRCm39) probably benign Het
Dnah2 T C 11: 69,406,617 (GRCm39) T542A possibly damaging Het
Dsc2 A T 18: 20,180,276 (GRCm39) I159N probably damaging Het
Ecel1 A T 1: 87,075,716 (GRCm39) V774E probably damaging Het
Eif5b T G 1: 38,084,560 (GRCm39) C849W probably damaging Het
Eif5b T A 1: 38,058,451 (GRCm39) L251* probably null Het
Ext2 T C 2: 93,592,956 (GRCm39) D416G probably damaging Het
Fancm G A 12: 65,153,388 (GRCm39) W1281* probably null Het
Flvcr1 A T 1: 190,743,829 (GRCm39) I409K possibly damaging Het
Foxk1 T C 5: 142,437,389 (GRCm39) probably null Het
Frem2 T A 3: 53,560,905 (GRCm39) I1201F possibly damaging Het
Gabra5 A G 7: 57,157,873 (GRCm39) probably benign Het
Gmpr2 G A 14: 55,915,778 (GRCm39) V319I probably damaging Het
Gna12 A T 5: 140,746,338 (GRCm39) L369Q probably damaging Het
Gpr160 A G 3: 30,950,914 (GRCm39) R329G probably benign Het
H2-M10.3 T C 17: 36,677,423 (GRCm39) H285R probably benign Het
H2-M2 A T 17: 37,793,424 (GRCm39) V194E probably benign Het
Hephl1 G A 9: 14,995,830 (GRCm39) R431W possibly damaging Het
Hr A G 14: 70,793,877 (GRCm39) T46A probably benign Het
Hr A G 14: 70,794,205 (GRCm39) H126R possibly damaging Het
Hsf1 T G 15: 76,382,398 (GRCm39) D256E probably benign Het
Ifi208 C T 1: 173,510,961 (GRCm39) T372I probably damaging Het
Ifi47 T G 11: 48,986,620 (GRCm39) F129C probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Irag2 A G 6: 145,120,257 (GRCm39) I491V probably benign Het
Itga11 A T 9: 62,670,171 (GRCm39) N765I probably benign Het
Klhl22 T A 16: 17,589,663 (GRCm39) I108K probably benign Het
Lancl1 T G 1: 67,073,381 (GRCm39) H34P probably benign Het
Lcor C A 19: 41,573,685 (GRCm39) N813K probably damaging Het
Mbd3l1 G A 9: 18,396,274 (GRCm39) G133D probably benign Het
Med12l T C 3: 59,155,353 (GRCm39) F1178L probably benign Het
Mrm1 A T 11: 84,705,531 (GRCm39) N289K probably damaging Het
Myf6 A G 10: 107,330,073 (GRCm39) Y165H probably benign Het
Myo1g C A 11: 6,456,913 (GRCm39) C971F probably benign Het
Myo3a T C 2: 22,245,862 (GRCm39) M3T probably benign Het
Nsrp1 G A 11: 76,937,114 (GRCm39) R361* probably null Het
Or10d4 A C 9: 39,580,611 (GRCm39) Q86P possibly damaging Het
Or10h1b C A 17: 33,395,548 (GRCm39) H57Q possibly damaging Het
Or4a69 T C 2: 89,312,756 (GRCm39) H241R probably damaging Het
Or4a77 T C 2: 89,487,731 (GRCm39) D18G probably damaging Het
Or5p6 A T 7: 107,631,163 (GRCm39) I129N possibly damaging Het
Or8b41 G A 9: 38,054,866 (GRCm39) C140Y probably benign Het
Or8k53 T A 2: 86,177,846 (GRCm39) D88V probably benign Het
Oscar T G 7: 3,614,663 (GRCm39) Y103S probably damaging Het
Pdpr A G 8: 111,852,925 (GRCm39) N610S probably benign Het
Ppp4r3b T C 11: 29,124,697 (GRCm39) I56T probably damaging Het
Pxdn T A 12: 30,044,552 (GRCm39) V510D possibly damaging Het
Rab11fip5 T C 6: 85,324,913 (GRCm39) S465G possibly damaging Het
Rasgrf2 T C 13: 92,267,759 (GRCm39) T82A probably benign Het
Scmh1 G A 4: 120,320,284 (GRCm39) W30* probably null Het
Sema4g T C 19: 44,981,071 (GRCm39) Y40H probably benign Het
Serpinf2 A T 11: 75,323,494 (GRCm39) M404K probably damaging Het
Sgk3 T C 1: 9,950,616 (GRCm39) probably null Het
Slc16a5 A T 11: 115,360,738 (GRCm39) Y307F possibly damaging Het
Slc39a5 G A 10: 128,233,628 (GRCm39) L290F probably damaging Het
Snx32 A C 19: 5,547,736 (GRCm39) D191E probably damaging Het
Sp4 T C 12: 118,262,859 (GRCm39) I396V probably benign Het
Srrd A G 5: 112,490,765 (GRCm39) V42A unknown Het
Stim1 A G 7: 102,080,257 (GRCm39) H547R unknown Het
Svep1 G A 4: 58,070,517 (GRCm39) A2423V probably benign Het
Tep1 A G 14: 51,066,687 (GRCm39) S2304P possibly damaging Het
Tkt C G 14: 30,281,795 (GRCm39) S104R probably benign Het
Tkt T C 14: 30,281,796 (GRCm39) S105P probably damaging Het
Tln1 A T 4: 43,542,893 (GRCm39) N1365K probably damaging Het
Topaz1 G T 9: 122,604,707 (GRCm39) A1104S probably benign Het
Trmt2a A G 16: 18,068,814 (GRCm39) H270R probably damaging Het
Ttll10 G T 4: 156,127,616 (GRCm39) T389K probably benign Het
Tubal3 A G 13: 3,980,674 (GRCm39) I129V probably benign Het
Ucp3 A G 7: 100,131,123 (GRCm39) E192G probably damaging Het
Usp47 A G 7: 111,677,063 (GRCm39) D448G probably damaging Het
Vps13d A G 4: 144,807,869 (GRCm39) probably null Het
Wdr7 A G 18: 63,910,939 (GRCm39) D777G possibly damaging Het
Zcchc8 A G 5: 123,847,300 (GRCm39) I213T probably damaging Het
Zfp281 T C 1: 136,555,143 (GRCm39) I707T probably damaging Het
Zfp335 T C 2: 164,735,395 (GRCm39) H1158R probably damaging Het
Zfp692 C T 11: 58,199,765 (GRCm39) T118M probably damaging Het
Zfr2 T A 10: 81,075,969 (GRCm39) L192Q probably benign Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19,286,007 (GRCm39) splice site probably benign
IGL01296:Vmn2r98 APN 17 19,285,447 (GRCm39) missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19,286,020 (GRCm39) missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19,285,521 (GRCm39) missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19,286,713 (GRCm39) missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19,286,548 (GRCm39) missense probably benign
IGL02123:Vmn2r98 APN 17 19,300,941 (GRCm39) missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19,286,113 (GRCm39) missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19,286,083 (GRCm39) missense probably benign
IGL02650:Vmn2r98 APN 17 19,301,223 (GRCm39) missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19,285,521 (GRCm39) missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19,286,275 (GRCm39) missense probably benign
IGL02807:Vmn2r98 APN 17 19,301,283 (GRCm39) missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19,286,242 (GRCm39) missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19,290,107 (GRCm39) missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19,301,223 (GRCm39) missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19,286,662 (GRCm39) missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19,286,089 (GRCm39) nonsense probably null
R0545:Vmn2r98 UTSW 17 19,273,875 (GRCm39) missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19,300,759 (GRCm39) missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19,300,782 (GRCm39) missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19,301,011 (GRCm39) missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19,286,210 (GRCm39) missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19,285,440 (GRCm39) missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19,301,170 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19,286,702 (GRCm39) missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19,286,680 (GRCm39) missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19,285,595 (GRCm39) nonsense probably null
R2165:Vmn2r98 UTSW 17 19,301,553 (GRCm39) missense unknown
R2238:Vmn2r98 UTSW 17 19,286,213 (GRCm39) missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19,300,698 (GRCm39) missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19,286,081 (GRCm39) missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19,301,439 (GRCm39) missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19,287,664 (GRCm39) missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19,300,887 (GRCm39) missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19,286,354 (GRCm39) missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19,290,007 (GRCm39) missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19,286,602 (GRCm39) missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19,286,419 (GRCm39) missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19,286,306 (GRCm39) missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19,273,815 (GRCm39) missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19,300,981 (GRCm39) missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19,290,016 (GRCm39) nonsense probably null
R5371:Vmn2r98 UTSW 17 19,290,015 (GRCm39) missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19,301,161 (GRCm39) missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19,286,260 (GRCm39) missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19,286,336 (GRCm39) missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19,286,143 (GRCm39) missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19,286,063 (GRCm39) missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19,285,510 (GRCm39) missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19,286,530 (GRCm39) missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19,301,184 (GRCm39) missense probably benign
R7068:Vmn2r98 UTSW 17 19,285,575 (GRCm39) missense probably benign
R7607:Vmn2r98 UTSW 17 19,287,570 (GRCm39) missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19,300,797 (GRCm39) missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19,287,460 (GRCm39) splice site probably null
R7915:Vmn2r98 UTSW 17 19,287,493 (GRCm39) missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19,273,912 (GRCm39) missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19,301,425 (GRCm39) missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19,301,031 (GRCm39) missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19,286,532 (GRCm39) missense probably benign
R8952:Vmn2r98 UTSW 17 19,285,531 (GRCm39) missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19,301,481 (GRCm39) missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19,286,777 (GRCm39) missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19,287,517 (GRCm39) missense probably benign 0.01
R9753:Vmn2r98 UTSW 17 19,285,665 (GRCm39) missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19,287,685 (GRCm39) nonsense probably null
Z1177:Vmn2r98 UTSW 17 19,285,398 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCATGGCCTTCTTGTCTAG -3'
(R):5'- GGCATCAGGTCTTAGATTCAGAG -3'

Sequencing Primer
(F):5'- GGCCTTCTTGTCTAGAAATTTGCCAG -3'
(R):5'- CAGGTCTTAGATTCAGAGAAGCTTTG -3'
Posted On 2022-07-18